RPL36-ribosomal protein L36 Gene View larger

RPL36-ribosomal protein L36 Gene

PTXBC004971

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPL36-ribosomal protein L36 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPL36-ribosomal protein L36 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004971
Product type: DNA & cDNA
Ncbi symbol: RPL36
Origin species: Human
Product name: RPL36-ribosomal protein L36 Gene
Size: 2ug
Accessions: BC004971
Gene id: 25873
Gene description: ribosomal protein L36
Synonyms: L36; 60S ribosomal protein L36; ribosomal protein L36
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctacgctaccctatggccgtgggcctcaacaagggccacaaagtgaccaagaacgtgagcaagcccaggcacagccgacgccgcgggcgtctgaccaaacacaccaagttcgtgcgggacatgattcgggaggtgtgtggctttgccccgtacgagcggcgcgccatggagttactgaaggtctccaaggacaaacgggccctcaaatttatcaagaaaagggtggggacgcacatccgcgccaagaggaagcgggaggagctgagcaacgtactggccgccatgaggaaagctgctgccaagaaagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S16
- ribosomal protein S13
- ribosomal protein S10
- ribosomal protein L18

Buy RPL36-ribosomal protein L36 Gene now

Add to cart