DNAL4-dynein, axonemal, light chain 4 Gene View larger

DNAL4-dynein, axonemal, light chain 4 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAL4-dynein, axonemal, light chain 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAL4-dynein, axonemal, light chain 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002968
Product type: DNA & cDNA
Ncbi symbol: DNAL4
Origin species: Human
Product name: DNAL4-dynein, axonemal, light chain 4 Gene
Size: 2ug
Accessions: BC002968
Gene id: 10126
Gene description: dynein, axonemal, light chain 4
Synonyms: MRMV3; PIG27; dynein light chain 4, axonemal; dynein light chain, outer arm 4; dynein, axonemal, light polypeptide 4; proliferation-inducing gene 27; proliferation-inducing protein 27; dynein axonemal light chain 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggagaaacagaagggaagaaagatgaggctgactataagcgactgcagaccttccctctggtcaggcactcggacatgccagaggagatgcgcgtggagaccatggagctatgtgtcacagcctgtgagaaattctccaacaacaacgagagcgccgccaagatgatcaaagagacaatggacaagaagttcggctcctcctggcacgtggtgatcggcgagggctttgggtttgagatcacccacgaggtgaagaacctcctctacctgtacttcgggggcaccctggctgtgtgcgtctggaagtgctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Sin3A-associated protein, 18kDa
- NECAP endocytosis associated 1
- tripartite motif-containing 41
- osteoclast stimulating factor 1

Buy DNAL4-dynein, axonemal, light chain 4 Gene now

Add to cart