SAP18-Sin3A-associated protein, 18kDa Gene View larger

SAP18-Sin3A-associated protein, 18kDa Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SAP18-Sin3A-associated protein, 18kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SAP18-Sin3A-associated protein, 18kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC030836
Product type: DNA & cDNA
Ncbi symbol: SAP18
Origin species: Human
Product name: SAP18-Sin3A-associated protein, 18kDa Gene
Size: 2ug
Accessions: BC030836
Gene id: 10284
Gene description: Sin3A-associated protein, 18kDa
Synonyms: histone deacetlyase complex subunit SAP18; histone deacetylase complex subunit SAP18; 2HOR0202; SAP18P; 18 kDa Sin3-associated polypeptide; Sin3A-associated protein, 18kDa; cell growth inhibiting protein 38; cell growth-inhibiting gene 38 protein; sin3-associated polypeptide, 18 kDa; sin3-associated polypeptide, p18; Sin3A associated protein 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggtggagtcgcgcgttacccaggaggaaattaagaaggagccagagaaaccgatcgaccgcgagaagacatgcccactgttgctacgggtcttcaccaccaataacggccgccaccaccgaatggacgagttctcccggggaaatgtaccgtccagcgagttgcagatctacacttggatggatgcaactttgaaagaactgacaagcttagtaaaagaagtctacccagaagctagaaagaagggcactcacttcaattttgcaatcgtttttacagatgttaaaagacctggctatcgagttaaggaaattggcagcaccatgtctggcagaaaggggactgatgattccatgaccctgcagtcgcagaagttccagataggagattacttggacatagcaattacccctccaaatcgggcaccacctacttcagggcgcatgagaccatattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NECAP endocytosis associated 1
- tripartite motif-containing 41
- osteoclast stimulating factor 1
- KH homology domain containing 1

Buy SAP18-Sin3A-associated protein, 18kDa Gene now

Add to cart