Login to display prices
Login to display prices
ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene View larger

ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene

PTXBC003564

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene

Proteogenix catalog: PTXBC003564
Ncbi symbol: ATP6V1G1
Product name: ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene
Size: 2ug
Accessions: BC003564
Gene id: 9550
Gene description: ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Synonyms: ATP6G; ATP6G1; ATP6GL; ATP6J; Vma10; V-type proton ATPase subunit G 1; ATPase, H+ transporting, lysosomal (vacuolar proton pump), member J; ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1; V-ATPase 13 kDa subunit 1; V-ATPase subunit G 1; vacuolar ATP synthase subunit M16; vacuolar H(+)-ATPase subunit G 1; vacuolar proton pump subunit G 1; vacuolar proton pump subunit M16; ATPase H+ transporting V1 subunit G1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagtcagtctcaggggattcagcagctgctgcaggccgagaagcgggcagccgagaaggtgtccgaggcccgcaaaagaaagaaccggaggctgaagcaggccaaagaagaagctcaggctgaaattgaacagtaccgcctgcagagggagaaagaattcaaggccaaggaagctgcggcattgggatcccgtggcagttgcagcactgaagtggagaaggagacccaggagaagatgaccatcctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: