ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene View larger

ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003564
Product type: DNA & cDNA
Ncbi symbol: ATP6V1G1
Origin species: Human
Product name: ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene
Size: 2ug
Accessions: BC003564
Gene id: 9550
Gene description: ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1
Synonyms: ATP6G; ATP6G1; ATP6GL; ATP6J; Vma10; V-type proton ATPase subunit G 1; ATPase, H+ transporting, lysosomal (vacuolar proton pump), member J; ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1; V-ATPase 13 kDa subunit 1; V-ATPase subunit G 1; vacuolar ATP synthase subunit M16; vacuolar H(+)-ATPase subunit G 1; vacuolar proton pump subunit G 1; vacuolar proton pump subunit M16; ATPase H+ transporting V1 subunit G1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctagtcagtctcaggggattcagcagctgctgcaggccgagaagcgggcagccgagaaggtgtccgaggcccgcaaaagaaagaaccggaggctgaagcaggccaaagaagaagctcaggctgaaattgaacagtaccgcctgcagagggagaaagaattcaaggccaaggaagctgcggcattgggatcccgtggcagttgcagcactgaagtggagaaggagacccaggagaagatgaccatcctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pleckstrin homology domain containing, family J member 1
- cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)
- regulatory factor X, 4 (influences HLA class II expression)
- chaperone, ABC1 activity of bc1 complex homolog (S. pombe)

Buy ATP6V1G1-ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G1 Gene now

Add to cart