Cart 114 Product Products 23 216,53 € (empty)
-
1 x C5orf49-ch...113,40 € -
-
-
-
-
1 x AEN-apopto...113,40 € -
1 x SRP14-sign...113,40 € -
1 x FAM89B-fam...113,40 € -
1 x NFIX-nucle...121,50 € -
-
-
-
1 x LSM3-LSM3...113,40 € -
1 x C15orf49-c...113,40 € -
1 x LOC653166-...113,40 € -
-
-
-
-
-
1 x SLC35A5-so...121,50 € -
1 x C11orf46-c...113,40 € -
1 x KLRA1-kill...113,40 € -
-
1 x AP1S2-adap...113,40 € -
1 x SERPINC1-s...113,40 € -
-
-
-
-
1 x FAM105A-fa...121,50 € -
1 x TCEA2-tran...113,40 € -
1 x BEX5-brain...113,40 € -
-
-
-
-
-
1 x EPN3-epsin...113,40 € -
1 x NPC2-Niema...113,40 € -
1 x FLOT2-flot...121,50 € -
1 x SPCS3-sign...113,40 € -
1 x TSPYL5-TSP...121,50 € -
1 x SFRS11-spl...121,50 € -
1 x CD209-CD20...121,50 € -
-
-
-
-
-
-
-
1 x CLPS-colip...113,40 € -
1 x CPVL-carbo...121,50 € -
-
-
-
-
1 x STARD3-StA...121,50 € -
1 x C7orf42-ch...113,40 € -
1 x EIF4E2-euk...113,40 € -
1 x LACRT-lacr...113,40 € -
-
-
1 x SSX4-synov...113,40 € -
1 x PARVA-parv...121,50 € -
1 x IFI27-inte...113,40 € -
1 x TMEM87A-tr...121,50 € -
-
-
1 x FLJ35220-h...113,40 € -
1 x TRMU-tRNA...113,40 € -
-
-
1 x CNOT7-CCR4...121,50 € -
1 x ST3GAL3-ST...121,50 € -
-
-
1 x N6AMT1-N-6...113,40 € -
1 x ZNF503-zin...121,50 € -
-
1 x SAMD3-ster...113,40 € -
1 x RABGAP1L-R...113,40 € -
1 x NOL4-nucle...121,50 € -
-
-
-
1 x TRAF1-TNF...121,50 € -
-
1 x GALNT3-UDP...113,40 € -
1 x PPP2CA-pro...121,50 € -
1 x DHRS1-dehy...121,50 € -
-
1 x CHMP5-chro...113,40 € -
-
-
-
-
-
-
-
1 x GNB2L1-gua...121,50 € -
1 x ACAD11-acy...121,50 € -
1 x C2orf63-ch...121,50 € -
-
1 x OLFM3-olfa...121,50 € -
1 x EHF-ets...121,50 € -
1 x TMEM120A-t...121,50 € -
-
-
-
1 x PQBP1-poly...113,40 € -
1 x KLHL3-kelc...121,50 € -
1 x C1orf58-ch...121,50 €
No products
To be determined Shipping
23 216,53 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 114 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 23 216,53 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 23 216,53 €
View larger 
Data sheet of KEL-Kell blood group, metallo-endopeptidase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KEL-Kell blood group, metallo-endopeptidase Gene
| Brand: | ProteoGenix |
| Availability: | PRODUCT NOT AVAILABLE |
| Proteogenix catalog: | PTXBC003135 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KEL |
| Origin species: | Human |
| Product name: | KEL-Kell blood group, metallo-endopeptidase Gene |
| Size: | 2ug |
| Accessions: | BC003135 |
| Gene id: | 3792 |
| Gene description: | Kell blood group, metallo-endopeptidase |
| Synonyms: | CD238; ECE3; kell blood group glycoprotein; kell blood group antigen; Kell blood group, metallo-endopeptidase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaggtggggaccaaagtgaggaagagccgagggaacgcagccaggcaggtggaatgggaactctctggagccaagagagcactccagaagagaggctgcccgtggaagggagcaggccatgggcagtggccaggcgggtgctgacagctatcctgattttgggcctgctcctttgtttttctgtgcttttgttctacaacttccagaactgtggccctcgcccctgtgagacatctgtgtgtttggatctccgggatcattacctggcctctgggaacacaagtgtggccccctgcaccgacttcttcagctttgcctgtggaagggccaaagagaccaataattcttttcaggagcttgccacaaagaacaaaaaccgacttcggagaatactggaggtccagaattcctggcacccaggctctggggaggagaaagccttccagttctacaactcctgcatggatacacttgccattgaagctgcagggactggtcccctcagacaagttattgaggagcttggaggctggcgcatctctggtaaatggacttccttaaactttaaccgaacgctgagacttctgatgagtcagtatggccatttccctttcttcagagcctacctaggacctcatcctgcctctccacacacaccagtcatccagatagaccagccagagtttgatgttcccctcaagcaagatcaagaacagaagatctatgcccagatctttcgggaatacctgacttacctgaatcagctgggaaccttgctgggaggagacccaagcaaggtgcaagaacactcttccttgtcaatctccatcacttcacggctgttccagtttctgaggcccctggagcagcggcgggcacagggcaagctcttccagatggtcactatcgaccagctcaaggaaatggcccccgccatcgactggttgtcctgcttgcaagcgacattcacaccgatgtccctgagcccttctcagtccctcgtggtccatgacgtggaatatttgaaaaacatgtcacaactggtggaggagatgctgctaaagcagagggactttctgcagagccacatgatcttagggctggtggtgaccctttctccagccctggacagtcaattccaggaggcacgcagaaagctcagccagaaactgcgggaactgacagagcaaccacccatgcctgcccgcccacgatggatgaagtgcgtggaggagacaggcacgttcttcgagcccacgctggcggctttgtttgttcgtgaggcctttggcccgagcacccgaagtgctgccatgaaattattcactgcgatccgggatgccctcatcactcgcctcagaaaccttccctggatgaatgaggagacccagaacatggcccaggacaaggttgctcaactgcaggtggagatgggggcttcagaatgggccctgaagccagagctggcccgacaagaatacaacgatatacagcttggatcgagcttcctgcagtctgtcctgagctgtgtccggtccctccgagctagaattgtccagagcttcttgcagcctcacccccaacacaggtggaaggtgtccccttgggacgtcaatgcttactattcggtatctgaccatgtggtagtctttccagctggactcctccaacccccattcttccaccctggctatcccagagccgtgaactttggcgctgctggcagcatcatggcccacgagctgttgcacatcttctaccagctcttactgcctgggggctgcctcgcctgtgacaaccatgccctccaggaagctcacctgtgcctgaagcgccattatgctgcctttccattacctagcagaacctccttcaatgactccctcacattcttagagaatgctgcagacgttggggggctagccatcgcgctgcaggcatacagcaagaggctgttacggcaccatggggagactgtcctgcccagcctggacctcagcccccagcagatcttctttcgaagctatgcccaggtgatgtgtaggaagcccagcccccaggactctcacgacactcacagccctccacacctccgagtccacgggcccctcagcagcaccccagcctttgccaggtatttccgctgtgcacgtggtgctctcttgaacccctccagccgctgccagctctggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cation channel, sperm associated 1 - breast carcinoma amplified sequence 2 - DIRAS family, GTP-binding RAS-like 2 - cation channel, sperm associated 2 |