EFHB-EF-hand domain family, member B Gene View larger

EFHB-EF-hand domain family, member B Gene


New product

Data sheet of EFHB-EF-hand domain family, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EFHB-EF-hand domain family, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028198
Product type: DNA & cDNA
Ncbi symbol: EFHB
Origin species: Human
Product name: EFHB-EF-hand domain family, member B Gene
Size: 2ug
Accessions: BC028198
Gene id: 151651
Gene description: EF-hand domain family, member B
Synonyms: CFAP21; EF-hand domain-containing family member B; cilia and flagella associated protein 21; EF-hand domain family member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaaccaagacaggaaatggaaaaagagtctacctgtgttttaatgaaacccaacacagagattaagcttcctgtggaggtggacattggactaacccaagccgaggggccagatgagactaagaatacagagccccaaatgggcttggtgatagaacctccccaatgccagtttgcccaacaacatgaacagagaaaggaggctggaaacattgaatcaggagtggaacctccagatcgcatcagacccatatactctgggaagttttttgatcggaccccttgctggccaagtgcaggaaaagttattccagttggttacagagttgcaacctgcttgactgaaaaacttcccaggctaattactccacctgaagcaaaaaagtatttcaacttcagatatccacctgctggagtagaaagagtattttacggaagagcaaatgatccccagattgcaccttatttgacacatggaattagatctaaaatttcgatactggcaaacacattgataaacccacagcctattaccacatttcaacagaaaattaaagataaaaaagaatctatatatcttagcaatcgacgagcaccattaggaaaatctcacgatcaagcaccaggattaccaaaaggcatggacacaatcaatacgacatttgggacagcagtcatcaaagaatactctgctaaagatgtggtgaatccaccaaaatcctatgaagaagtatttaaagaaggaaatgaaggacatgatttgtatgttgtttctcacaatgattattatgcaggagaggcaaagaaccgaaagtataacccatcaagtttccataggtgtagtgtgtatggagtaccaacaccacattttaatgatggacgagccatggcaaaatctctatattggctccatgaactacaaatgaaaagaggagctaagtttgtatccaaaagagcagatgatttcaaagaaaagtttcaacataaacttggaagagttttagatcccattgcagaaacaatgaatgttcccccagactgcacatttggagcttgtctccgtcctgaggaatatggagttggtgatctcatccataatagacttccggatgaatatcttcgaggcaaggatagacagcgagccctgattgcagcagttcggcatcacctgaagaaagttaattaccaaaagtttgacactttgctggcagccttcaggcactatgacaagaagggagatgggatgatagataaagacgagctgcaggaagcttgtgaccaggccaacttgagtttagatgacaagctcctggaccagctatttgactactgtgatgtggataatgatggcttcattaactatctggaattcgcaaattttcttaactggaaagacaaaatgcttcttaaagagtatgaagagagggtcattattaaaggtagaaaaccagattgtgtaaaccctactgaggctaatgttgaagaacctgaacaaactctcctcataaagccagaagatattgtcttaaaagaagcaggaagcacagaaaagactctccggacacttctgagaccaagtgataaagtttccaactactataagacaacttcttctgagatcaatgcaattgtaggagccattccttctacttgttaccccatttgtggtgttccaaccattcgatctgacattcctgctccccgaattcgtcgcatcagtgacagaactaattatggtgaagaaggtagtgcatattcactactatatcctaccatttttgcccggaaaggagtgtttgaaagagacttcttcaagaccagatcaaaagaagagattgcagagatattgtgtaacattggtgtcaaactgtctgatgaagaatttgaaaatgtatggaatcttgcatcaaaaaagcatcacagaggagaagtttgtgttgagaacatcagaaatgttctagatgagctacggcatgcagaccggatcaagtgtaaaacactcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - BMX non-receptor tyrosine kinase
- guanine monphosphate synthetase
- leucine rich repeat neuronal 2
- RNA binding motif protein 12B

Buy EFHB-EF-hand domain family, member B Gene now

Add to cart