ARHGEF5-Rho guanine nucleotide exchange factor (GEF) 5 Gene View larger

ARHGEF5-Rho guanine nucleotide exchange factor (GEF) 5 Gene

PTXBC010046

New product

Data sheet of ARHGEF5-Rho guanine nucleotide exchange factor (GEF) 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGEF5-Rho guanine nucleotide exchange factor (GEF) 5 Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC010046
Product type: DNA & cDNA
Ncbi symbol: ARHGEF5
Origin species: Human
Product name: ARHGEF5-Rho guanine nucleotide exchange factor (GEF) 5 Gene
Size: 2ug
Accessions: BC010046
Gene id: 7984
Gene description: Rho guanine nucleotide exchange factor (GEF) 5
Synonyms: GEF5; P60; TIM; TIM1; rho guanine nucleotide exchange factor 5; Rho guanine nucleotide exchange factor (GEF) 5; ephexin-3; guanine nucleotide regulatory protein TIM; oncogene TIM; p60 TIM; transforming immortalized mammary oncogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaggcttttcaagacgctgctccaaactcatcaactcctcccagctgctttaccaggagtatagtgatgttgtcctgaataaggagatccagagccagcagcggctggagagcctgtccgagacacccgggcctagctctccgcggcagcctcggaaggccctggtctcctccgagtcgtacctgcagcggctctccatggcctccagcggctccctctggcaggaaatccccgtggtgcgcaacagcaccgtgctgctctccatgacccatgaagaccaaaagctgcaagaggtcaaatttgagctgattgtgtcagaggcctcctacctgcgcagtctaaacatagctgtggatcatttccaactttcaacttcactccgggccacactttccaaccaggagcaccaatggctcttctctcgtttacaggatgtgcgagacgtcagcgccacgttcctttcagacctggaagagaactttgagaacaatatcttctccttccaagtatgtgacgtagtcctgaaccacgccccagacttccgccgggtctacctgccttatgtcaccaaccagacctatcaggaacgcaccttccagagcctgatgaatagcaacagcaatttccgggaggtcttggagaagctggagagcgaccccgtctgccagcgcctttccctcaagtcctttctgattctgcccttccaacgcatcacccgcctcaaactgctgctccagaacattctgaagagaacacagcctggctcctcggaggaggcagaggccacgaaggcacaccacgccctggagcagctgatccgggactgcaataacaatgtccagagtatgcgacggacagaggagctaatctacctgagccagaagattgagtttgagtgcaaaatattcccgctcatttctcagtcacgctggctggtgaaaagtggggagctgacagccttggagttcagtgcttccccagggctacgaaggaagctgaacacgcgtccagtccacctgcacctcttcaatgactgtctgctgctgtctcggccccgagagggtagccgattcctggtatttgaccatgctcccttctcctccattcggggggaaaagtgtgaaatgaagctacatggacctcacaaaaacctgttccgactctttctgcggcagaacactcagggcgcccaggccgagttcctcttccgcacggagactcaaagtgaaaagcttcggtggatctcagccttggccatgccaagagaggagttggaccttctggagtgttacaactccccccaggtacagtgccttcgagcctacaagccccgagagaatgatgaattggcactggagaaagccgacgtggtgatggtgactcagcagagcagtgacggctggctggagggcgtgaggctctcagacggggagcgaggctggtttcctgtgcagcaggtggagttcatttccaacccagaggtccgtgcacagaacctgaaggaagctcatcgagtcaagactgccaaactacagctggtggaacagcaagcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibronectin leucine rich transmembrane protein 1
- inner membrane protein, mitochondrial (mitofilin)
- cyclin-dependent kinase 2 associated protein 2
- arachidonate 5-lipoxygenase-activating protein

Buy ARHGEF5-Rho guanine nucleotide exchange factor (GEF) 5 Gene now

Add to cart