FRS2-fibroblast growth factor receptor substrate 2 Gene View larger

FRS2-fibroblast growth factor receptor substrate 2 Gene


New product

Data sheet of FRS2-fibroblast growth factor receptor substrate 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FRS2-fibroblast growth factor receptor substrate 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021562
Product type: DNA & cDNA
Ncbi symbol: FRS2
Origin species: Human
Product name: FRS2-fibroblast growth factor receptor substrate 2 Gene
Size: 2ug
Accessions: BC021562
Gene id: 10818
Gene description: fibroblast growth factor receptor substrate 2
Synonyms: FRS1A; FRS2A; FRS2alpha; SNT; SNT-1; SNT1; fibroblast growth factor receptor substrate 2; FGFR signalling adaptor; FGFR substrate 2; FGFR-signaling adaptor SNT; suc1-associated neurotrophic factor target 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtagctgttgtagctgtccagataaagacactgtcccagataaccatcggaacaagtttaaggtcattaatgtggatgatgatgggaatgagttaggttctggcataatggaacttacagacacagaactgattttatacacccgcaaacgtgactcagtaaaatggcactacctctgcctgcgacgctatggctatgactcgaatctcttttcttttgaaagtggtcgaaggtgtcaaactggacaaggaatctttgcctttaagtgtgcccgtgcagaagaattatttaacatgttgcaagagattatgcaaaataatagtataaatgtggtggaagagccagttgtagaaagaaataatcatcagacagaattggaagtccctagaacacctcgaacacctacaactccaggatttgctgctcagaacttacctaatggatatccccgatatccctcatttggagatgcttcatcccatccgtcaagcagacatccttctgtgggaagtgctcgcctgccttcagtaggggaagaatctacacatcctttgcttgtggctgaggaacaagtacatacctatgtcaacactacaggtgtgcaagaagagcggaaaaaccgcacaagtgtgcatgttccattggaggcaagggtttctaacgctgaaagcagcacaccaaaagaagaaccaagtagtattgaggacagggatcctcagattcttcttgaacctgaaggagtcaaatttgttttagggccaacccctgttcaaaagcagttaatggaaaaagagaaactggagcaacttggaagagatcaagttagtggaagtggagcaaataacacagaatgggacactggctatgacagtgatgaacgaagagatgcaccctctgttaacaaactggtgtatgaaaatataaatgggctatctatccctagtgcctcaggggtcaggagaggtcgtctgacatccaccagtacctcagatacccagaatatcaacaactcagctcagagaagaactgcattattaaactatgaaaatctaccatctttgcctcctgtttgggaagcccgcaagctaagtagggatgaagatgacaatttaggaccaaagaccccatctctaaatggctaccataataatctagatccaatgcataactatgtaaatacagagaatgtaacagtgccagcaagtgctcacaaaatagaatattcaaggcgtcgggactgtacaccaacagtctttaactttgatatcagacgcccaagtttagaacacaggcagcttaattacatacaggttgacttggaaggtggcagtgactctgacaaccctcagactccaaaaacgcctacaactccccttccacaaacccctaccaggcgcacagagctgtatgccgtgatagacatcgagagaactgctgctatgtcaaatttgcagaaagcactgccacgagatgatggtacatctaggaaaactagacacaatagtactgatctgcccatgttagcctggaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - IMP (inosine monophosphate) dehydrogenase 2
- cell division cycle 25 homolog A (S. pombe)
- discoidin, CUB and LCCL domain containing 1
- intracisternal A particle-promoted polypeptide

Buy FRS2-fibroblast growth factor receptor substrate 2 Gene now

Add to cart