Login to display prices
Login to display prices
IMPDH2-IMP (inosine monophosphate) dehydrogenase 2 Gene View larger

IMPDH2-IMP (inosine monophosphate) dehydrogenase 2 Gene

PTXBC006124

New product

Data sheet of IMPDH2-IMP (inosine monophosphate) dehydrogenase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IMPDH2-IMP (inosine monophosphate) dehydrogenase 2 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC006124
Ncbi symbol: IMPDH2
Product name: IMPDH2-IMP (inosine monophosphate) dehydrogenase 2 Gene
Size: 2ug
Accessions: BC006124
Gene id: 3615
Gene description: IMP (inosine monophosphate) dehydrogenase 2
Synonyms: IMPD2; IMPDH-II; inosine-5'-monophosphate dehydrogenase 2; IMP (inosine 5'-monophosphate) dehydrogenase 2; IMP (inosine monophosphate) dehydrogenase 2; IMP oxireductase 2; IMPD 2; IMPDH 2; inosine 5' phosphate dehydrogenase 2; inosine monophosphate dehydrogenase type II; inosine monophosphate dehydrogenase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgactacctgattagtgggggcacgtcctacgtgccagacgacggactcacagcacagcagctcttcaactgcggagacggcctcacctacaatgactttctcattctccctgggtacatcgacttcactgcagaccaggtggacctgacttctgctctgaccaagaaaatcactcttaagaccccactggtttcctctcccatggacacagtcacagaggctgggatggccatagcaatggcgcttacaggcggtattggcttcatccaccacaactgtacacctgaattccaggccaatgaagttcggaaagtgaagaaatatgaacagggattcatcacagaccctgtggtcctcagccccaaggatcgcgtgcgggatgtttttgaggccaaggcccggcatggtttctgcggtatcccaatcacagacacaggccggatggggagccgcttggtgggcatcatctcctccagggacattgattttctcaaagaggaggaacatgactgtttcttggaagagataatgacaaagagggaagacttggtggtagcccctgcaggcatcacactgaaggaggcaaatgaaattctgcagcgcagcaagaagggaaagttgcccattgtaaatgaagatgatgagcttgtggccatcattgcccggacagacctgaagaagaatcgggactacccactagcctccaaagatgccaagaaacagctgctgtgtggggcagccattggcactcatgaggatgacaagtataggctggacttgctcgcccaggctggtgtggatgtagtggttttggactcttcccagggaaattccatcttccagatcaatatgatcaagtacatcaaagacaaataccctaatctccaagtcattggaggcaatgtggtcactgctgcccaggccaagaacctcattgatgcaggtgtggatgccctgcgggtgggcatgggaagtggctccatctgcattacgcaggaagtgctggcctgtgggcggccccaagcaacagcagtgtacaaggtgtcagagtatgcacggcgctttggtgttccggtcattgctgatggaggaatccaaaatgtgggtcatattgcgaaagccttggcccttggggcctccacagtcatgatgggctctctcctggctgccaccactgaggcccctggtgaatacttcttttccgatgggatccggctaaagaaatatcgcggtatgggttctctcgatgccatggacaagcacctcagcagccagaacagatatttcagtgaagctgacaaaatcaaagtggcccagggagtgtctggtgctgtgcaggacaaagggtcaatccacaaatttgtcccttacctgattgctggcatccaacactcatgccaggacattggtgccaagagcttgacccaagtccgagccatgatgtactctggggagcttaagtttgagaagagaacgtcctcagcccaggtggaaggtggcgtccatagcctccattcgtatgagaagcggcttttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: