IKZF3-IKAROS family zinc finger 3 (Aiolos) Gene View larger

IKZF3-IKAROS family zinc finger 3 (Aiolos) Gene


New product

Data sheet of IKZF3-IKAROS family zinc finger 3 (Aiolos) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IKZF3-IKAROS family zinc finger 3 (Aiolos) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032707
Product type: DNA & cDNA
Ncbi symbol: IKZF3
Origin species: Human
Product name: IKZF3-IKAROS family zinc finger 3 (Aiolos) Gene
Size: 2ug
Accessions: BC032707
Gene id: 22806
Gene description: IKAROS family zinc finger 3 (Aiolos)
Synonyms: AIO; AIOLOS; ZNFN1A3; zinc finger protein Aiolos; zinc finger DNA binding protein Aiolos; zinc finger protein, subfamily 1A, 3 (Aiolos); IKAROS family zinc finger 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagatatacaaacaaatgcggaactgaaaagcactcaggagcagtctgtgcccgcagaaagtgcagcggttttgaatgactacagtttaaccaaatctcatgaaatggaaaatgtggacagtggagaaggcccagccaatgaagatgaagacataggagatgattcaatgaaagtgaaagatgaatacagtgaaagagatgagaatgttttaaagtcagaacccatgggaaatgcagaagagcctgaaatcccttacagctattcaagagaatataatgaatatgaaaacattaagttggagagacatgttgtctcattcgatagtagcaggccaaccagtggaaagatgaactgcgatgtgtgtggattatcctgcatcagcttcaatgtcttaatggttcataagcgaagccatactggtgaacgcccattccagtgtaatcagtgtggggcatcttttactcagaaaggtaacctcctccgccacattaaactgcacacaggggaaaaaccttttaagtgtcacctctgcaactatgcatgccaaagaagagatgcgctcacggggcatcttaggacacattctgtggagaaaccctacaaatgtgagttttgtggaaggagttacaagcagagaagttcccttgaggagcacaaggagcgctgccgtacatttcttcagagcactgacccaggggacactgcaagtgcggaggcaagacacatcaaagcagagatgggaagtgaaagagctctcgtactggacagattagcaagcaatgtggcaaaacgaaaaagctcaatgcctcagaaattcattggtgagaagcgccactgctttgatgtcaactataattcaagttacatgtatgagaaagagagtgagctcatacagacccgcatgatggaccaagccatcaataacgccatcagctatcttggcgccgaagccctgcgccccttggtccagacaccgcctgctcccacctcggagatggttccagttatcagcagcatgtatcccatagccctcacccgggctgagatgtcaaacggtgcccctcaagagctggaaaagaaaagcatccaccttccagagaagagcgtgccttctgagagaggcctctctcccaacaatagtggccacgactccacggacactgacagcaaccatgaagaacgccagaatcacatctatcagcaaaatcacatggtcctgtctcgggcccgcaatgggatgccacttctgaaggaggttccccgctcttacgaactcctcaagcccccgcccatctgcccaagagactccgtcaaagtgatcaacaaggaaggggaggtgatggatgtgtatcggtgtgaccactgccgcgtcctcttcctggactatgtgatgttcacgattcacatgggctgccacggcttccgtgaccctttcgagtgtaacatgtgtggatatcgaagccatgatcggtatgagttctcgtctcacatagccagaggagaacacagagccctgctgaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - poly-U binding splicing factor 60KDa
- Wolf-Hirschhorn syndrome candidate 2
- chromosome 1 open reading frame 92
- chromosome 6 open reading frame 10

Buy IKZF3-IKAROS family zinc finger 3 (Aiolos) Gene now

Add to cart