PUF60-poly-U binding splicing factor 60KDa Gene View larger

PUF60-poly-U binding splicing factor 60KDa Gene

PTXBC011265

New product

Data sheet of PUF60-poly-U binding splicing factor 60KDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PUF60-poly-U binding splicing factor 60KDa Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC011265
Product type: DNA & cDNA
Ncbi symbol: PUF60
Origin species: Human
Product name: PUF60-poly-U binding splicing factor 60KDa Gene
Size: 2ug
Accessions: BC011265
Gene id: 22827
Gene description: poly-U binding splicing factor 60KDa
Synonyms: poly(U)-binding-splicing factor PUF60; FIR; RoBPI; SIAHBP1; VRJS; FBP interacting repressor; FUSE-binding protein-interacting repressor; Ro ribonucleoprotein-binding protein 1; Siah binding protein 1; poly(U) binding splicing factor 60KDa; pyrimidine tract binding splicing factor; poly(U) binding splicing factor 60
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagaacgggcagagcacagccgccaagctggggctgcctcccctgacgcccgagcagcaggaggcccttcagaaggccaagaagtacgccatggagcagagcatcaagagtgtgctggtgaagcagaccatcgcgcaccagcagcagcagctcaccaacctgcagatggcagcagtgacaatgggctttggagatcctctctcacctttgcaatcgatggcggctcagcggcagcgggcgctggccatcatgtgccgcgtctacgtgggctctatctactatgagctgggggaggacaccatccgccaggcctttgccccctttggccccatcaagagcatcgacatgtcctgggactccgtcaccatgaagcacaagggctttgccttcgtggagtatgaggtccccgaagctgcacagctggccttggagcagatgaactcggtgatgctggggggcaggaacatcaaggtgggcagacccagcaacatagggcaggcccagcccatcatagaccagttggctgaggaggcacgggccttcaaccgcatctacgtggcctctgtgcaccaggacctctcagacgatgacatcaagagcgtgtttgaggcctttggcaagatcaagtcctgcacactggcccgggaccccacaactggcaagcacaagggctacggcttcattgagtacgagaaggcccagtcgtcccaagatgctgtgtcttccatgaacctctttgacctgggtggccagtacttgcgggtgggcaaggctgtcacaccgcccatgcccctactcacaccagccacgcctggaggcctcccacctgccgctgctgtggcagctgctgcagccactgccaagatcacagctcaggaagcagtggccggagcagcggtgctgggtaccctgggcacacctggactggtgtccccagcactgaccctggcccagcccctgggcactttgccccaggctgtcatggctgcccaggcacctggagtcatcacaggtgtgaccccagcccgtcctcctatcccggtcaccatcccctcggtgggagtggtgaaccccatcctggccagccctccaacgctgggtctcctggagcccaagaaggagaaggaagaagaggagctgtttcccgagtcagagcggccagagatgctgagcgagcaggagcacatgagcatctcgggcagtagcgcccgacacatggtgatgcagaagctgctccgcaagcaggagtctacagtgatggttctgcgcaacatggtggaccccaaggacatcgatgatgacctggaaggggaggtgacagaggagtgtggcaagttcggggccgtgaaccgcgtcatcatctaccaagagaaacaaggcgaggaggaggatgcagaaatcattgtcaagatctttgtggagttttccatagcctctgagactcataaggccatccaggccctcaatggccgctggtttgctggccgcaaggtggtggctgaagtgtacgaccaggagcgttttgataacagtgacctctctgcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Wolf-Hirschhorn syndrome candidate 2
- chromosome 1 open reading frame 92
- chromosome 6 open reading frame 10
- chromosome 7 open reading frame 38

Buy PUF60-poly-U binding splicing factor 60KDa Gene now

Add to cart