CBARA1-calcium binding atopy-related autoantigen 1 Gene View larger

CBARA1-calcium binding atopy-related autoantigen 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBARA1-calcium binding atopy-related autoantigen 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CBARA1-calcium binding atopy-related autoantigen 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004190
Product type: DNA & cDNA
Ncbi symbol: CBARA1
Origin species: Human
Product name: CBARA1-calcium binding atopy-related autoantigen 1 Gene
Size: 2ug
Accessions: BC004190
Gene id: 10367
Gene description: calcium binding atopy-related autoantigen 1
Synonyms: CBARA1; CALC; EFHA3; MPXPS; calcium uptake protein 1, mitochondrial; ara CALC; atopy-related autoantigen CALC; calcium-binding atopy-related autoantigen 1; mitochondrial calcium uptake 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcgtctgaactcactttctgctttggcagaactggctgtgggttctcgatggtaccatggaggatcacagcccatccagatccggcgaagactaatgatggtggctttcctgggagcatctgcagtaactgcaagtactggtcttttgtggaagagggcccatgcagaatctccaccatgtgtagacaacctaaaaagtgacatcggtgataaagggaagaataaagatgaaggggatgtttgtaaccatgagaaaaagactgcagatcttgcccctcacccagaagagaaaaagaagaaacgttctggattcagagacagaaaagtgatggaatatgagaataggattcgagcctactccacgccagacaaaatcttccgatattttgccaccttgaaagtcatcagtgagcctggtgaagcagaagtgtttatgacaccagaagattttgtgcgatccataacacccaatgaaaaacaaccagaacacttgggtctggatcaatatataataaaacgctttgatggaaagaaaatttcccaggaacgagaaaaatttgctgatgaaggcagtatattttacacccttggagaatgtgggctcatatccttttcagactacattttcctcacaactgttctttccactcctcagagaaattttgaaattgccttcaagatgtttgatttgaatggagatggagaagtagatatggaagaatttgaacaggttcagagcatcattcgctcccaaaccagtatgggtatgcgccacagagatcgtccaactactggcaacaccctcaagtctggcttgtgttcagccctcacaacctacttttttggagctgatctgaagggaaagctgacaatcaaaaacttcctcgaatttcagcgtaaactgcagcatgatgttctgaagcttgagtttgaacgccatgaccctgtggatgggagaattactgagaggcagtttggtggcatgctacttgcctacagtggggtgcagtccaagaagctgaccgccatgcagaggcagctcaagaagcacttcaaagaaggaaagggtctgacatttcaggaggtggagaacttctttactttcctaaagaacattaatgatgtggacactgcattgagtttttaccatatggctggagcatctcttgataaagtgaccatgcagcaggtggccaggacagtggctaaagtggagctctcagaccacgtgtgtgatgtggtgtttgcactctttgactgtgatggcaatggcgaactgagcaataaggaatttgtttccatcatgaagcaacggctgatgagaggcctggaaaagcccaaagacatgggtttcactcgcctcatgcaggccatgtggaaatgtgcacaggaaactgcctgggacttcgctttacccaaacagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aldehyde dehydrogenase 1 family, member A2
- DnaJ (Hsp40) homolog, subfamily A, member 3
- DnaJ (Hsp40) homolog, subfamily C, member 7
- La ribonucleoprotein domain family, member 6

Buy CBARA1-calcium binding atopy-related autoantigen 1 Gene now

Add to cart