DNAJA3-DnaJ (Hsp40) homolog, subfamily A, member 3 Gene View larger

DNAJA3-DnaJ (Hsp40) homolog, subfamily A, member 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DNAJA3-DnaJ (Hsp40) homolog, subfamily A, member 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DNAJA3-DnaJ (Hsp40) homolog, subfamily A, member 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011855
Product type: DNA & cDNA
Ncbi symbol: DNAJA3
Origin species: Human
Product name: DNAJA3-DnaJ (Hsp40) homolog, subfamily A, member 3 Gene
Size: 2ug
Accessions: BC011855
Gene id: 9093
Gene description: DnaJ (Hsp40) homolog, subfamily A, member 3
Synonyms: HCA57; TID1; hTID-1; dnaJ homolog subfamily A member 3, mitochondrial; DnaJ (Hsp40) homolog, subfamily A, member 3; dnaJ protein Tid-1; hepatocellular carcinoma-associated antigen 57; tumorous imaginal discs protein Tid56 homolog; DnaJ heat shock protein family (Hsp40) member A3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcgcggtgctccacacgctggttgctggtggttgtggggaccccgcggctgccggctatatcgggtagaggggcccggccgcccagggagggcgtggtgggggcatggctgagccgcaagctgagcgtccccgcctttgcgtcttccctgacctcttgcggcccccgagcgctgctgacattgagacctggtgtcagcctcacaggaacaaaacattaccctttcatttgtactgcctccttccacacgagtgcccctttggccaaagaagattattatcagatattaggagtgcctcgaaatgccagccagaaagagatcaagaaagcctattatcagcttgccaagaagtatcaccctgacacaaataaggatgatcccaaagccaaggagaagttctcccagctggcagaagcctatgaggttttgagtgatgaggtgaagaggaagcagtacgatgcctacggctctgcaggcttcgatcctggggccagcggctcccagcatagctactggaagggaggccccactgtggaccccgaggagctgttcaggaagatctttggcgagttctcatcctcttcatttggagatttccagaccgtgtttgatcagcctcaggaatacttcatggagttgacattcaatcaagctgcaaagggggtcaacaaggagttcaccgtgaacatcatggacacgtgtgagcgctgcaacggcaaggggaacgagcccggcaccaaggtgcagcattgccactactgtggcggctccggcatggaaaccatcaacacaggcccttttgtgatgcgttccacgtgtaggagatgtggtggccgcggctccatcatcatatcgccctgtgtggtctgcaggggagcaggacaagccaagcagaaaaagcgagtgatgatccctgtgcctgcaggagtcgaggatggccagaccgtgaggatgcctgtgggaaaaagggaaattttcattacgttcagggtgcagaaaagccctgtgttccggagggacggcgcagacatccactccgacctctttatttctatagctcaggctcttcttgggggaacagccagagcccagggcctgtacgagacgatcaacgtgacgatcccccctgggactcagacagaccagaagattcggatgggtgggaaaggcatcccccggattaacagctacggctacggagaccactacatccacatcaagatacgagttccaaagaggctaacgagccggcagcagagcctgatcctgagctacgccgaggacgagacagatgtggaggggacggtgaacggcgtcaccctcaccagctctggtggcagcaccatggatagctccgcaggaagcaaggctaggcgtgaggctggggaggacgaggagggattcctttccaaacttaagaaaatgtttacctcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DnaJ (Hsp40) homolog, subfamily C, member 7
- La ribonucleoprotein domain family, member 6
- DnaJ (Hsp40) homolog, subfamily C, member 7
- aldehyde dehydrogenase 1 family, member L1

Buy DNAJA3-DnaJ (Hsp40) homolog, subfamily A, member 3 Gene now

Add to cart