Login to display prices
Login to display prices
CAMK1G-calcium/calmodulin-dependent protein kinase IG Gene View larger

CAMK1G-calcium/calmodulin-dependent protein kinase IG Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CAMK1G-calcium/calmodulin-dependent protein kinase IG Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CAMK1G-calcium/calmodulin-dependent protein kinase IG Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032787
Product type: DNA & cDNA
Ncbi symbol: CAMK1G
Origin species: Human
Product name: CAMK1G-calcium/calmodulin-dependent protein kinase IG Gene
Size: 2ug
Accessions: BC032787
Gene id: 57172
Gene description: calcium/calmodulin-dependent protein kinase IG
Synonyms: CLICK3; CLICKIII; VWS1; dJ272L16.1; calcium/calmodulin-dependent protein kinase type 1G; CLICK III; caM kinase I gamma; caM kinase IG; caM-KI gamma; caMK-like CREB kinase III; caMKI gamma; caMKIG; calcium/calmodulin dependent protein kinase IG
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcgaaaggaagaagatgactgcagttcctggaagaaacagaccaccaacatccggaaaaccttcatttttatggaagtgctgggatcaggagctttctcagaagttttcctggtgaagcaaagactgactgggaagctctttgctctgaagtgcatcaagaagtcacctgccttccgggacagcagcctggagaatgagattgctgtgttgaaaaagatcaagcatgaaaacattgtgaccctggaggacatctatgagagcaccacccactactacctggtcatgcagcttgtttctggtggggagctctttgaccggatcctggagcggggtgtctacacagagaaggatgccagtctggtgatccagcaggtcttgtcggcagtgaaatacctacatgagaatggcatcgtccacagagacttaaagcccgaaaacctgctttaccttacccctgaagagaactctaagatcatgatcactgactttggtctgtccaagatggaacagaatggcatcatgtccactgcctgtgggaccccaggctacgtggctccagaagtgctggcccagaaaccctacagcaaggctgtggattgctggtccatcggcgtcatcacctacatattgctctgtggataccccccgttctatgaagaaacggagtctaagcttttcgagaagatcaaggagggctactatgagtttgagtctccattctgggatgacatttctgagtcagccaaggactttatttgccacttgcttgagaaggatccgaacgagcggtacacctgtgagaaggccttgagtcatccctggattgacggaaacacagccctccaccgggacatctacccatcagtcagcctccagatccagaagaactttgctaagagcaagtggaggcaagccttcaacgcagcagctgtggtgcaccacatgaggaagctacacatgaacctgcacagcccgggcgtccgcccagaggtggagaacaggccgcctgaaactcaagcctcagaaacctctagacccagctcccctgagatcaccatcaccgaggcacctgtcctggaccacagtgtagcactccctgccctgacccaattaccctgccagcatggccgccggcccactgcccctggtggcaggtccctcaactgcctggtcaatggctccctccacatcagcagcagcctggtgcccatgcatcaggggtccctggccgccgggccctgtggctgctgctccagctgcctgaacattgggagcaaaggaaagtcctcctactgctctgagcccacactcctcaaaaaggccaacaaaaaacagaacttcaagtcggaggtcatggtaccagttaaagccagtggcagctcccactgccgggcagggcagactggagtctgtctcattatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine/threonine kinase 3 (STE20 homolog, yeast)
- beta-1,3-N-acetylgalactosaminyltransferase 2
- patatin-like phospholipase domain containing 2
- kelch repeat and BTB (POZ) domain containing 4