Login to display prices
Login to display prices
GEFT-RhoA/RAC/CDC42 exchange factor Gene View larger

GEFT-RhoA/RAC/CDC42 exchange factor Gene

PTXBC012860

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GEFT-RhoA/RAC/CDC42 exchange factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GEFT-RhoA/RAC/CDC42 exchange factor Gene

Proteogenix catalog: PTXBC012860
Ncbi symbol: GEFT
Product name: GEFT-RhoA/RAC/CDC42 exchange factor Gene
Size: 2ug
Accessions: BC012860
Gene id: 115557
Gene description: RhoA/RAC/CDC42 exchange factor
Synonyms: rhoA/Rac/Cdc42 guanine nucleotide exchange factor GEFT; rac/Cdc42/Rho exchange factor GEFT; guanine nucleotide exchange factor GEFT; GEFT; p63RhoGEF; rho guanine nucleotide exchange factor 25; RAC/CDC42 exchange factor; Rho guanine nucleotide exchange factor (GEF) 25; RhoA/RAC/CDC42 exchange factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttggagccagctctagccacaggagaggagctgccggaactgaccttgctgaccacactgttggagggccctggagataagacgcagccacctgaagaggagactttgtcccaagcccctgagagtgaggaggaacagaagaagaaggctctggaaaggagtatgtatgtcctgagtgaactggtagaaacagagaaaatgtacgtggacgacttggggcagattgtggagggttatatggccaccatggctgctcagggggtccccgagagtcttcgaggccgtgacaggattgtgtttgggaatatccagcaaatctatgagtggcaccgagactatttcttgcaagagctacaacggtgtctgaaagatcctgattggctggctcagctattcatcaaacacgagcgccggctgcatatgtatgtggtgtactgtcagaataagcccaagtcagagcatgtggtgtcagagtttggggacagctactttgaggagctccggcagcagctggggcaccgcctgcagctgaacgacctcctcatcaaacctgtgcagcggatcatgaaataccagctgctgctcaaggattttctcaagtattacaatagagctgggatggatactgcagacctagagcaagctgtggaggtcatgtgctttgtgcccaagcgctgcaacgatatgatgacgctggggagattgcggggatttgagggcaaactgactgctcaggggaagctcttgggccaggacactttctgggtcaccgagcctgaggctggagggctgctatcttcccgaggtcgagagaggcgcgtcttcctctttgagcaaatcatcatcttcagtgaagccctgggaggaggagtgagaggtggaacacagcctggatatgtatacaagaacagcattaaggtgagctgcctgggactggaggggaacctccaaggtgacccttgccgctttgcactgacctccagagggccagagggtgggatccagcgctatgtcctgcaggctgcagaccctgctatcagtcaggcctggatcaagcatgtggctcagatcttggagagccaacgggacttcctcaacgcattgcagtcacccattgagtaccagagacgggagagccagaccaacagcctggggcggccaagagggcctggagtggggagccctggaagaattcggcttggagatcaggcccagggcagcacacacacacccatcaatggctctctcccctctctgctgctgtcacccaaaggggaggtggccagagccctcttgccactggataaacaggcccttggtgacatcccccaggctccccatgactctcctccagtctctccaactccaaaaacccctccctgccaagccagacttgccaagctggatgaagatgagctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: