Login to display prices
Login to display prices
LMBR1-limb region 1 homolog (mouse) Gene View larger

LMBR1-limb region 1 homolog (mouse) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LMBR1-limb region 1 homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LMBR1-limb region 1 homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017663
Product type: DNA & cDNA
Ncbi symbol: LMBR1
Origin species: Human
Product name: LMBR1-limb region 1 homolog (mouse) Gene
Size: 2ug
Accessions: BC017663
Gene id: 64327
Gene description: limb region 1 homolog (mouse)
Synonyms: ACHP; C7orf2; DIF14; LSS; PPD2; THYP; TPT; ZRS; limb region 1 protein homolog; differentiation-related gene 14 protein; limb region 1 homolog; limb development membrane protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagggcaggacgaggtgtcggcgcgggagcagcacttccacagccaagtgcgggagtccacgatatgtttccttctttttgccattctctacgttgtttcctacttcatcatcacaagatacaagagaaaatcagatgaacaagaagatgaagatgccatcgtcaacaggatttcgttgtttttgagcacgttcactctcgcagtgtcagctggggctgttttgcttttacccttctcaatcatcagcaatgaaatcctgctttcttttcctcagaactactatattcagtggctaaatggctccctgattcatggtttgtggaatcttgcttcccttttttccaacctttgtttatttgtattgatgccctttgcctttttctttctggaatcagaaggctttgctggcctgaaaaagggaatccgagcccgcattttagagactttggtcatgcttcttcttcttgcgttactcattcttgggatagtgtgggtagcttcagcactcattgacaacgatgccgcaagcatggaatctttatatgatctctgggagttctatctaccctatttatattcctgtatatcattgatgggatgtttgttacttctcttgtgtacaccagttggcctttctcgtatgttcacagtgatgggtcagttgctagtgaagccaacaattcttgaagacctggatgaacaaatttatatcattaccttagaggaagaagcactccagagacgactaaatgggctgtcttcatcggtggaatacaacataatggagttggaacaagaacttgaaaatgtaaagactcttaagacaaaattagagaggcgaaaaaaggcttcagcatgggaaagaaatttggtgtatcccgctgttatggttctccttcttattgagacatccatctcggtcctcttggtggcttgtaatattctttgcctattggttgatgaaacagcaatgccaaaaggaacaagggggcctggaataggaaatgcctctctttctacgtttggttttgtgggagctgcgcttgaaatcattttgattttctatcttatggtgtcctctgttgtcggcttctatagccttcgattttttggaaactttactcccaagaaagatgacacaactatgacaaagatcattggaaattgtgtgtccatcttggttttgagctctgctctgcctgtgatgtcgagaacactgggaatcactagatttgatctacttggcgactttggaaggtttaattggctgggaaatttctatattgtattatcctacaatttgctttttgctattgtgacaacattgtgtctggtccgaaaattcacctctgcagttcgagaagaacttttcaaggccctagggcttcataaacttcacttaccaaatacttcaagggattcagaaacagccaagccttctgtaaatgggcatcagaaagcactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon regulatory factor 5
- poliovirus receptor-related 4
- FCH and double SH3 domains 2
- t-complex 11 (mouse)-like 2