BRSK1-BR serine/threonine kinase 1 Gene View larger

BRSK1-BR serine/threonine kinase 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BRSK1-BR serine/threonine kinase 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BRSK1-BR serine/threonine kinase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016681
Product type: DNA & cDNA
Ncbi symbol: BRSK1
Origin species: Human
Product name: BRSK1-BR serine/threonine kinase 1 Gene
Size: 2ug
Accessions: BC016681
Gene id: 84446
Gene description: BR serine/threonine kinase 1
Synonyms: serine/threonine-protein kinase BRSK1; hSAD1; BR serine/threonine-protein kinase 1; SAD1 homolog; SAD1 kinase; SadB kinase short isoform; brain-selective kinase 1; brain-specific serine/threonine-protein kinase 1; protein kinase SAD1A; serine/threonine-protein kinase SAD-B; synapses of Amphids Defective homolog 1; BR serine/threonine kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggagcctgccatccaacggagagctggaccccgacgtcctagagagcatggcatcactgggctgcttcagggaccgcgagaggctgcatcgcgagctgcgcagtgaggaggagaaccaagaaaagatgatatattatctgcttttggatcggaaggagcggtatcccagctgtgaggaccaggacctgcctccccggaatgatgttgaccccccccggaagcgtgtggattctcccatgctgagtcgtcacgggaagcggcgaccagagcggaagtccatggaagtcctgagcatcaccgatgccgggggtggtggctcccctgtacccacacgacgggccttggagatggcccagcacagccagagatcccgtagcgtcagtggagcctccacgggtctgtcctccagccctctaagcagcccaaggagtccggtcttttccttttcaccggagccgggggctggagatgaggctcgaggcgggggctccccgacttccaaaacgcagacgctgccttctcggggccccaggggtgggggcgccggggagcagcccccgccccccagtgcccgctccacacccctgcccggccccccaggctccccgcgctcctctggcgggacccccttgcactcgcctctgcacacgccccgggccagtcccaccgggaccccggggacaacaccaccccccagccccggcggtggcgtcgggggagccgcctggaggagtcgtctcaactccatccgcaacagcttcctgggctcccctcgctttcaccggcgcaagatgcaggtccctaccgctgaggagatgtccagcttgacgccagagtcctccccggagctggcaaaacgctcctggttcgggaacttcatctccttggacaaagaagaacaaatattcctcgtgctaaaggacaaacctctcagcagcatcaaagcagacatcgtccatgcctttctgtcgatccccagcctgagtcacagtgtgctgtcacagaccagcttcagggccgagtacaaagccagtggcggcccctccgtcttccaaaagcccgtccgcttccaggtggacatcagctcctctgagggtccagagccctccccgcgacgggacggcagcggaggtggtggcatctactccgtcaccttcactctcatctcgggtcccagccgtcggttcaagcgagtggtggagaccatccaggcacagctcctgagcactcatgaccagccctccgtgcaggccctggcagacgagaagaacggggcccagacccggcctgctggtgccccaccccgaagcctgcagcccccacccggccgcccagacccagagctgagcagctctccccgccgagccccccccaaggacaagaagctcctggccaccaacgggacccctctgccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch domain containing 7B
- integrator complex subunit 4
- RAR-related orphan receptor A
- RNA binding motif protein 46

Buy BRSK1-BR serine/threonine kinase 1 Gene now

Add to cart