Login to display prices
Login to display prices
BRSK1-BR serine/threonine kinase 1 Gene View larger

BRSK1-BR serine/threonine kinase 1 Gene

PTXBC016681

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BRSK1-BR serine/threonine kinase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BRSK1-BR serine/threonine kinase 1 Gene

Proteogenix catalog: PTXBC016681
Ncbi symbol: BRSK1
Product name: BRSK1-BR serine/threonine kinase 1 Gene
Size: 2ug
Accessions: BC016681
Gene id: 84446
Gene description: BR serine/threonine kinase 1
Synonyms: serine/threonine-protein kinase BRSK1; hSAD1; BR serine/threonine-protein kinase 1; SAD1 homolog; SAD1 kinase; SadB kinase short isoform; brain-selective kinase 1; brain-specific serine/threonine-protein kinase 1; protein kinase SAD1A; serine/threonine-protein kinase SAD-B; synapses of Amphids Defective homolog 1; BR serine/threonine kinase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcggagcctgccatccaacggagagctggaccccgacgtcctagagagcatggcatcactgggctgcttcagggaccgcgagaggctgcatcgcgagctgcgcagtgaggaggagaaccaagaaaagatgatatattatctgcttttggatcggaaggagcggtatcccagctgtgaggaccaggacctgcctccccggaatgatgttgaccccccccggaagcgtgtggattctcccatgctgagtcgtcacgggaagcggcgaccagagcggaagtccatggaagtcctgagcatcaccgatgccgggggtggtggctcccctgtacccacacgacgggccttggagatggcccagcacagccagagatcccgtagcgtcagtggagcctccacgggtctgtcctccagccctctaagcagcccaaggagtccggtcttttccttttcaccggagccgggggctggagatgaggctcgaggcgggggctccccgacttccaaaacgcagacgctgccttctcggggccccaggggtgggggcgccggggagcagcccccgccccccagtgcccgctccacacccctgcccggccccccaggctccccgcgctcctctggcgggacccccttgcactcgcctctgcacacgccccgggccagtcccaccgggaccccggggacaacaccaccccccagccccggcggtggcgtcgggggagccgcctggaggagtcgtctcaactccatccgcaacagcttcctgggctcccctcgctttcaccggcgcaagatgcaggtccctaccgctgaggagatgtccagcttgacgccagagtcctccccggagctggcaaaacgctcctggttcgggaacttcatctccttggacaaagaagaacaaatattcctcgtgctaaaggacaaacctctcagcagcatcaaagcagacatcgtccatgcctttctgtcgatccccagcctgagtcacagtgtgctgtcacagaccagcttcagggccgagtacaaagccagtggcggcccctccgtcttccaaaagcccgtccgcttccaggtggacatcagctcctctgagggtccagagccctccccgcgacgggacggcagcggaggtggtggcatctactccgtcaccttcactctcatctcgggtcccagccgtcggttcaagcgagtggtggagaccatccaggcacagctcctgagcactcatgaccagccctccgtgcaggccctggcagacgagaagaacggggcccagacccggcctgctggtgccccaccccgaagcctgcagcccccacccggccgcccagacccagagctgagcagctctccccgccgagccccccccaaggacaagaagctcctggccaccaacgggacccctctgccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: