RORA-RAR-related orphan receptor A Gene View larger

RORA-RAR-related orphan receptor A Gene


New product

Data sheet of RORA-RAR-related orphan receptor A Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RORA-RAR-related orphan receptor A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008831
Product type: DNA & cDNA
Ncbi symbol: RORA
Origin species: Human
Product name: RORA-RAR-related orphan receptor A Gene
Size: 2ug
Accessions: BC008831
Gene id: 6095
Gene description: RAR-related orphan receptor A
Synonyms: NR1F1; ROR1; ROR2; ROR3; RZR-ALPHA; RZRA; nuclear receptor ROR-alpha; ROR-alpha; nuclear receptor RZR-alpha; nuclear receptor subfamily 1 group F member 1; retinoic acid receptor-related orphan receptor alpha; retinoid-related orphan receptor alpha; thyroid hormone nuclear receptor alpha variant 4; transcription factor RZR-alpha; RAR related orphan receptor A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtcagctccggcagcccccgaccccgccgccagcgagccaggcagcagcggcgcggacgcggccgccggctccagggagaccccgctgaaccaggaatccgcccgcaagagcgagccgcctgccccggtgcgcagacagagctattccagcaccagcagaggtatctcagtaacgaagaagacacatacatctcaaattgaaattattccatgcaagatctgtggagacaaatcatcaggaatccattatggtgtcattacatgtgaaggctgcaagggctttttcaggagaagtcagcaaagcaatgccacctactcctgtcctcgtcagaagaactgtttgattgatcgaaccagtagaaaccgctgccaacactgtcgattacagaaatgccttgccgtagggatgtctcgagatgctgtaaaatttggccgaatgtcaaaaaagcagagagacagcttgtatgcagaagtacagaaacaccggatgcagcagcagcagcgcgaccaccagcagcagcctggagaggctgagccgctgacgcccacctacaacatctcggccaacgggctgacggaacttcacgacgacctcagtaactacattgacgggcacacccctgaggggagtaaggcagactccgccgtcagcagcttctacctggacatacagccttccccagaccagtcaggtcttgatatcaatggaatcaaaccagaaccaatatgtgactacacaccagcatcaggcttctttccctactgttcgttcaccaacggcgagacttccccaactgtgtccatggcagaattagaacaccttgcacagaatatatctaaatcgcatctggaaacctgccaatacttgagagaagagctccagcagataacgtggcagacctttttacaggaagaaattgagaactatcaaaacaagcagcgggaggtgatgtggcaattgtgtgccatcaaaattacagaagctatacagtatgtggtggagtttgccaaacgcattgatggatttatggaactgtgtcaaaatgatcaaattgtgcttctaaaagcaggttctctagaggtggtgtttatcagaatgtgccgtgcctttgactctcagaacaacaccgtgtactttgatgggaagtatgccagccccgacgtcttcaaatccttaggttgtgaagactttattagctttgtgtttgaatttggaaagagtttatgttctatgcacctgactgaagatgaaattgcattattttctgcatttgtactgatgtcagcagatcgctcatggctgcaagaaaaggtaaaaattgaaaaactgcaacagaaaattcagctagctcttcaacacgtcctacagaagaatcaccgagaagatggaatactaacaaagttaatatgcaaggtgtctacattaagagccttatgtggacgacatacagaaaagctaatggcatttaaagcaatatacccagacattgtgcgacttcattttcctccattatacaaggagttgttcacttcagaatttgagccagcaatgcaaattgatgggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein 46
- HLA-B associated transcript 5
- hyaluronan binding protein 2
- period homolog 1 (Drosophila)

Buy RORA-RAR-related orphan receptor A Gene now

Add to cart