NSUN6-NOL1/NOP2/Sun domain family, member 6 Gene View larger

NSUN6-NOL1/NOP2/Sun domain family, member 6 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NSUN6-NOL1/NOP2/Sun domain family, member 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NSUN6-NOL1/NOP2/Sun domain family, member 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035778
Product type: DNA & cDNA
Ncbi symbol: NSUN6
Origin species: Human
Product name: NSUN6-NOL1/NOP2/Sun domain family, member 6 Gene
Size: 2ug
Accessions: BC035778
Gene id: 221078
Gene description: NOL1/NOP2/Sun domain family, member 6
Synonyms: 4933414E04Rik; ARL5B-AS1; NOPD1; ARL5B antisense RNA 1; NOL1/NOP2/Sun and PUA domain-containing protein 1; NOL1/NOP2/Sun domain family, member 6; NOP2/Sun domain family, member 6; nucleolar protein (NOL1/NOP2/sun) and PUA domains 1; NOP2/Sun RNA methyltransferase family member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctattttccctaagatatctttgagacctgaggttgaaaactatcttaaggaaggctttatgaataaggagattgtgactgctttaggtaaacaagaagcagaaaggaagtttgaaactttgttaaagcacctgtcacatcctccatcatttacaactgtcagagtgaatacacatttagcctcagtacaacatgtgaaaaatctgttacttgatgaacttcagaagcagtttaatggattaagtgttcctattcttcaacatccagaccttcaagatgtgttacttattcctgttattggacccagaaagaatattaaaaaacaacagtgtgaagccattgttggagcccagtgtggcaatgcagttttaagaggagcccatgtctatgccccaggaattgtgtcagcatcacaatttatgaaagctggagatgttatttctgtatactctgatattaaaggaaaatgtaagaaaggagccaaagaatttgatggaacaaaagtatttcttggaaatgggatttctgaactaagccgcaaagaaatcttcagtggattacctgaactgaaaggcatgggcataagaatgacagaaccagtatatctcagcccttcatttgacagtgtactgccccgttacttatttttacaaaatttgccatctgccttagtaagtcatgtactaaatcctcaacctggagagaagattctagacttgtgtgcagcacctggagggaaaacaacacacattgcagcactaatgcatgatcagggagaagttatagcactggataaaatcttcaacaaagtagaaaaaatcaaacagaatgccttattgttagggctgaattccatcagggcattttgttttgatggaacaaaggcggttaaacttgatatggtggaggacacagaaggagaacctccatttctaccagaatcctttgaccgaattcttctggatgcaccctgtagtggaatgggacagagaccaaacatggcctgtacttggtctgtgaaggaagtggcatcatatcagccattacagcgaaaactcttcactgcagcggttcagctgctgaagccagagggtgtgctggtttatagcacgtgcactataacactggccgaaaatgaagaacaggttgcctgggccctgacaaaatttccttgccttcagcttcagccccaggaaccgcagattggaggagaaggaatgaggggagctgggctctcatgtgaacagttgaaacagctgcagcgatttgatccatcggctgtgccattaccggacactgacatggactctcttagagaggccagaagagaagacatgttgcgtctggctaataaggactctataggtttttttattgcaaaatttgtaaaatgcaaaagcacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - scavenger receptor class B, member 2
- immunoglobulin heavy constant alpha 1
- nucleosome assembly protein 1-like 3
- prolyl 4-hydroxylase, beta polypeptide

Buy NSUN6-NOL1/NOP2/Sun domain family, member 6 Gene now

Add to cart