SCARB2-scavenger receptor class B, member 2 Gene View larger

SCARB2-scavenger receptor class B, member 2 Gene

PTXBC021892

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCARB2-scavenger receptor class B, member 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCARB2-scavenger receptor class B, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021892
Product type: DNA & cDNA
Ncbi symbol: SCARB2
Origin species: Human
Product name: SCARB2-scavenger receptor class B, member 2 Gene
Size: 2ug
Accessions: BC021892
Gene id: 950
Gene description: scavenger receptor class B, member 2
Synonyms: AMRF; CD36L2; EPM4; HLGP85; LGP85; LIMP-2; LIMPII; SR-BII; lysosome membrane protein 2; 85 kDa lysosomal membrane sialoglycoprotein; 85 kDa lysosomal sialoglycoprotein scavenger receptor class B, member 2; CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II); CD36 antigen-like 2; LIMP II; lysosome membrane protein II; scavenger receptor class B member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccgatgctgcttctacacggcggggacgttgtccctgctcctgctggtgaccagcgtcacgctgctggtggcccgggtcttccagaaggctgtagaccagagtatcgagaagaaaattgtgttaaggaatggtactgaggcatttgactcctgggagaagccccctctgcctgtgtatactcagttctatttcttcaatgtcaccaatccagaggagatcctcagaggggagacccctcgggtggaagaagtggggccatacacctacagggaactcagaaacaaagcaaatattcaatttggagataatggaacaacaatatctgctgttagcaacaaggcctatgtttttgaacgagaccaatctgttggagaccctaaaattgacttaattagaacattaaatattcctgtattgactgtcatagagtggtcccaggtgcacttcctcagggagatcatcgaggccatgttgaaagcctatcagcagaagctctttgtgactcacacagttgacgaattgctctggggctacaaagatgaaatcttgtcccttatccatgttttcaggcccgatatctctccctattttggcctattctatgagaaaaatgggactaatgatggagactatgtttttctaactggagaagacagttaccttaactttacaaaaattgtggaatggaatgggaaaacgtcacttgactggtggataacagacaagtgcaatatgattaatggaacagatggagattcttttcacccactaataaccaaagatgaggtcctttatgtcttcccatctgacttttgcaggtcagtgtatattactttcagtgactatgagagtgtacagggactgcctgcctttcggtataaagttcctgcagaaatattagccaatacgtcagacaatgccggcttctgtatacctgagggaaactgcctgggctcaggagttctgaatgtcagcatctgcaagaatggtgcacccatcattatgtctttcccacacttttaccaagcagatgagaggtttgtttctgccatagaaggcatgcacccaaatcaggaagaccatgagacatttgtggacattaatcctttgactggaataatcctaaaagcagccaagaggttccaaatcaacatttatgtcaaaaaattagatgactttgttgaaacgggagacattagaaccatggttttcccagtgatgtacctcaatgagagtgttcacattgataaagagacggcgagtcgactgaagtctatgattaacactactttgatcatcaccaacataccctacatcatcatggcgctgggtgtgttctttggtttggtttttacctggcttgcatgcaaaggacagggatccatggatgagggaacagcggatgaaagagcacccctcattcgaacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin heavy constant alpha 1
- nucleosome assembly protein 1-like 3
- prolyl 4-hydroxylase, beta polypeptide
- germ cell-less homolog 1 (Drosophila)

Buy SCARB2-scavenger receptor class B, member 2 Gene now

Add to cart