UFSP2-UFM1-specific peptidase 2 Gene View larger

UFSP2-UFM1-specific peptidase 2 Gene

PTXBC010493

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UFSP2-UFM1-specific peptidase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UFSP2-UFM1-specific peptidase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010493
Product type: DNA & cDNA
Ncbi symbol: UFSP2
Origin species: Human
Product name: UFSP2-UFM1-specific peptidase 2 Gene
Size: 2ug
Accessions: BC010493
Gene id: 55325
Gene description: UFM1-specific peptidase 2
Synonyms: BHD; C4orf20; ufm1-specific protease 2; UFM1 specific peptidase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgatttcagaaagtatggatatactcttcagaataagaggaggccttgatttggcttttcagctagctactcctaatgaaatttttctcaagaaggcactgaaacatgtgttgagtgacctgtcaactaagctgtcttcaaacgcccttgtgttcagaatttgccacagttcagtgtatatatggcctagcagtgacataaacaccattcctggagaactgactgatgcttctgcttgtaagaccatactgcgctttattcaatttgagccagaagaagatataaaaagaaaattcatgagaaagaaggacaaaaagttatcagacatgcatcaaatagtaaatatagatcttatgctggaaatgtcaacctccctggcagctgtaacgcccatcattgaaagggaaagcggaggacaccattatgttaatatgactttacctgtcgatgcagttatatctgttgctccagaagaaacatggggaaaagttcgtaaactcctggttgatgcaattcataatcaactaactgacatggaaaaatgtattttgaaatatatgaaaggaacatctattgtggtccctgaaccactgcactttttattaccagggaaaaaaaatcttgtaacaatttcatatccttcaggaataccagatggccagctgcaggcctataggaaggagttacatgatcttttcaatctgcctcacgacagaccctatttcaaaaggtctaatgcttatcactttccagatgagccatacaaagatggttacattagaaatccacatacttaccttaatccacctaacatggagactggtatgatttatgtggtccagggcatatatggctatcatcattatatgcaggatcgcatagatgacaatggctggggctgtgcttatcgatctctgcagactatctgctcttggttcaaacatcagggatacacagagaggtccattccaacacacagagaaattcagcaggctctagtcgatgccggggacaaaccagcaacatttgtcggatcgcggcaatggattggatctattgaggtgcagctggtactaaaccaattgatcggtataacgtcaaaaatcctgtttgtcagccaaggttcagaaattgcctctcaaggacgggaactggctaatcatttccaaagtgaaggaactccagttatgatcgggggaggagttttggcccacacaatactaggagttgcatggaatgagattacagggcagataaagtttctgattctagatccacattataccggtgctgaagacctgcaagttattttggaaaagggctggtgcggatggaagggcccagatttttggaacaaggatgcatactataacttatgtcttcctcagcgaccaaatatgatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - complement factor properdin
- pseudouridylate synthase 3
- centrosomal protein 63kDa
- ADP-dependent glucokinase

Buy UFSP2-UFM1-specific peptidase 2 Gene now

Add to cart