Login to display prices
Login to display prices
PUS3-pseudouridylate synthase 3 Gene View larger

PUS3-pseudouridylate synthase 3 Gene

PTXBC004822

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PUS3-pseudouridylate synthase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PUS3-pseudouridylate synthase 3 Gene

Proteogenix catalog: PTXBC004822
Ncbi symbol: PUS3
Product name: PUS3-pseudouridylate synthase 3 Gene
Size: 2ug
Accessions: BC004822
Gene id: 83480
Gene description: pseudouridylate synthase 3
Synonyms: 2610020J05Rik; FKSG32; MRT55; tRNA pseudouridine(38/39) synthase; tRNA pseudouridine synthase 3; tRNA pseudouridylate synthase 3; tRNA-uridine isomerase 3; pseudouridylate synthase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgataatgacacagacagaaaccagactgagaagctcctaaaaagagtacgagaactggagcaagaggtgcaaagacttaaaaaggaacaggccaaaaataaggaggactcaaacattagagaaaattcatcaggagctggaaaaactaagcgtgcatttgatttcagtgctcatggccgaagacacgtagccctaagaatagcctatatgggctggggataccagggctttgctagtcaggaaaacacaaataataccattgaagagaaactgtttgaagctctaaccaagactcgactagtagaaagcagacagacatccaactatcaccgatgtgggagaacagataaaggagttagtgcctttggacaggtgatctcacttgaccttcgctctcagtttccaaggggcagggattccgaggactttaatgtaaaagaggaggctaatgctgctgctgaagagatccgttatacccacattctcaatcgggtactccctccagacatccgtatattggcctgggcccctgtagaaccaagcttcagtgctaggttcagctgccttgagcggacttaccgctattttttccctcgtgctgatttagatattgtaaccatggattatgcagctcagaagtatgttggcacccatgatttcaggaacttgtgtaaaatggatgtagccaacggtgtgattaattttcagaggactattctatctgctcaagtacagctagtgggccagagcccaggtgaggggagatggcaagaacctttccagttatgtcagtttgaagtgactggccaggcattcctttatcatcaagtccgatgtatgatggctatcctctttctgattggccaaggaatggagaagccagagattattgatgagctgctgaatatagagaaaaatccccaaaagcctcaatatagtatggctgtagaatttcctctagtcttatatgactgtaagtttgaaaatgtcaagtggatctatgaccaggaggctcaggagttcaatattacccacctacaacaactgtgggctaatcatgctgtcaaaactcacatgttgtatagtatgctacaaggactggacactgttccagtaccctgtggaataggaccaaagatggatggaatgacagaatggggaaatgttaagccctctgtcataaagcagaccagtgcctttgtagaaggagtgaagatgcgcacatataagcccctcatggaccgtcctaaatgccaaggactggaatcccggatccagcattttgtacgtaggggacgaattgagcacccacatttattccatgaggaagaaacaaaagccaaaagggactgtaatgacacactagaggaagacaatactaatttggagacaccaacgaagagggtctgtgttgacacagaaattaaaagcatcatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: