PUS3-pseudouridylate synthase 3 Gene View larger

PUS3-pseudouridylate synthase 3 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PUS3-pseudouridylate synthase 3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PUS3-pseudouridylate synthase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004822
Product type: DNA & cDNA
Ncbi symbol: PUS3
Origin species: Human
Product name: PUS3-pseudouridylate synthase 3 Gene
Size: 2ug
Accessions: BC004822
Gene id: 83480
Gene description: pseudouridylate synthase 3
Synonyms: 2610020J05Rik; FKSG32; MRT55; tRNA pseudouridine(38/39) synthase; tRNA pseudouridine synthase 3; tRNA pseudouridylate synthase 3; tRNA-uridine isomerase 3; pseudouridylate synthase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgataatgacacagacagaaaccagactgagaagctcctaaaaagagtacgagaactggagcaagaggtgcaaagacttaaaaaggaacaggccaaaaataaggaggactcaaacattagagaaaattcatcaggagctggaaaaactaagcgtgcatttgatttcagtgctcatggccgaagacacgtagccctaagaatagcctatatgggctggggataccagggctttgctagtcaggaaaacacaaataataccattgaagagaaactgtttgaagctctaaccaagactcgactagtagaaagcagacagacatccaactatcaccgatgtgggagaacagataaaggagttagtgcctttggacaggtgatctcacttgaccttcgctctcagtttccaaggggcagggattccgaggactttaatgtaaaagaggaggctaatgctgctgctgaagagatccgttatacccacattctcaatcgggtactccctccagacatccgtatattggcctgggcccctgtagaaccaagcttcagtgctaggttcagctgccttgagcggacttaccgctattttttccctcgtgctgatttagatattgtaaccatggattatgcagctcagaagtatgttggcacccatgatttcaggaacttgtgtaaaatggatgtagccaacggtgtgattaattttcagaggactattctatctgctcaagtacagctagtgggccagagcccaggtgaggggagatggcaagaacctttccagttatgtcagtttgaagtgactggccaggcattcctttatcatcaagtccgatgtatgatggctatcctctttctgattggccaaggaatggagaagccagagattattgatgagctgctgaatatagagaaaaatccccaaaagcctcaatatagtatggctgtagaatttcctctagtcttatatgactgtaagtttgaaaatgtcaagtggatctatgaccaggaggctcaggagttcaatattacccacctacaacaactgtgggctaatcatgctgtcaaaactcacatgttgtatagtatgctacaaggactggacactgttccagtaccctgtggaataggaccaaagatggatggaatgacagaatggggaaatgttaagccctctgtcataaagcagaccagtgcctttgtagaaggagtgaagatgcgcacatataagcccctcatggaccgtcctaaatgccaaggactggaatcccggatccagcattttgtacgtaggggacgaattgagcacccacatttattccatgaggaagaaacaaaagccaaaagggactgtaatgacacactagaggaagacaatactaatttggagacaccaacgaagagggtctgtgttgacacagaaattaaaagcatcatttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centrosomal protein 63kDa
- ADP-dependent glucokinase
- prenylcysteine oxidase 1
- fatty acyl CoA reductase 1

Buy PUS3-pseudouridylate synthase 3 Gene now

Add to cart