Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC29A1-solute carrier family 29 (nucleoside transporters), member 1 Gene
PTXBC001382
New product
Data sheet of SLC29A1-solute carrier family 29 (nucleoside transporters), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC29A1-solute carrier family 29 (nucleoside transporters), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001382 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC29A1 |
| Origin species: | Human |
| Product name: | SLC29A1-solute carrier family 29 (nucleoside transporters), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC001382 |
| Gene id: | 2030 |
| Gene description: | solute carrier family 29 (nucleoside transporters), member 1 |
| Synonyms: | ENT1; equilibrative nucleoside transporter 1; equilibrative nitrobenzylmercaptopurine riboside (NBMPR)-sensitive nucleoside transporter; nucleoside transporter, es-type; solute carrier family 29 (equilibrative nucleoside transporter), member 1; solute carrier family 29 (nucleoside transporters), member 1; solute carrier family 29 member 1 (Augustine blood group) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacaaccagtcaccagcctcaggacagatacaaagctgtctggcttatcttcttcatgctgggtctgggaacgctgctcccgtggaattttttcatgacggccactcagtatttcacaaaccgcctggacatgtcccagaatgtgtccttggtcactgctgaactgagcaaggacgcccaggcgtcagccgcccctgcagcacccttgcctgagcggaactctctcagtgccatcttcaacaatgtcatgaccctatgtgccatgctgcccctgctgttattcacctacctcaactccttcctgcatcagaggatcccccagtccgtacggatcctgggcagcctggtggccatcctgctggtgtttctgatcactgccatcctggtgaaggtgcagctggatgctctgcccttctttgtcatcaccatgatcaagatcgtgctcattaattcatttggtgccatcctgcagggcagcctgtttggtctggctggccttctgcctgccagctacacggcccccatcatgagtggccagggcctagcaggcttctttgcctccgtggccatgatctgcgctattgccagtggctcggagctatcagaaagtgccttcggctactttatcacagcctgtgctgttatcattttgaccatcatctgttacctgggcctgccccgcctggaattctaccgctactaccagcagctcaagcttgaaggacccggggagcaggagaccaagttggacctcattagcaaaggagaggagccaagagcaggcaaagaggaatctggagtttcagtctccaactctcagcccaccaatgaaagccactctatcaaagccatcctgaaaaatatctcagtcctggctttctctgtctgcttcatcttcactatcaccattgggatgtttccagccgtgactgttgaggtcaagtccagcatcgcaggcagcagcacctgggaacgttacttcattcctgtgtcctgtttcttgactttcaatatctttgactggttgggccggagcctcacagctgtattcatgtggcctgggaaggacagccgctggctgccaagcctggtgctggcccggctggtgtttgtgccactgctgctgctgtgcaacattaagccccgccgctacctgactgtggtcttcgagcacgatgcctggttcatcttcttcatggctgcctttgccttctccaacggctacctcgccagcctctgcatgtgcttcgggcccaagaaagtgaagccagctgaggcagagaccgcaggagccatcatggccttcttcctgtgtctgggtctggcactgggggctgttttctccttcctgttccgggcaattgtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 23 (nucleobase transporters), member 3 - solute carrier family 17 (anion/sugar transporter), member 5 - myocilin, trabecular meshwork inducible glucocorticoid response - solute carrier family 18 (vesicular acetylcholine), member 3 |