Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC17A5-solute carrier family 17 (anion/sugar transporter), member 5 Gene
PTXBC020961
New product
Data sheet of SLC17A5-solute carrier family 17 (anion/sugar transporter), member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC17A5-solute carrier family 17 (anion/sugar transporter), member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020961 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC17A5 |
| Origin species: | Human |
| Product name: | SLC17A5-solute carrier family 17 (anion/sugar transporter), member 5 Gene |
| Size: | 2ug |
| Accessions: | BC020961 |
| Gene id: | 26503 |
| Gene description: | solute carrier family 17 (anion/sugar transporter), member 5 |
| Synonyms: | AST; ISSD; NSD; SIALIN; SIASD; SLD; H(+)/nitrate cotransporter; H(+)/sialic acid cotransporter; membrane glycoprotein HP59; sialic acid storage disease; sodium/sialic acid cotransporter; solute carrier family 17 (acidic sugar transporter), member 5; solute carrier family 17 (anion/sugar transporter), member 5; vesicular H(+)/Aspartate-glutamate cotransporter; solute carrier family 17 member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggtctccggttcgagacctggcccggaacgatggcgaggagagcacggaccgcacgcctcttctaccgggcgccccacgggccgaagccgctccagtgtgctgctctgctcgttacaacttagcaattttggccttttttggtttcttcattgtgtatgcattacgtgtgaatctgagtgttgcgttagtggatatggtagattcaaatacaactttagaagataatagaacttccaaggcatgtccagagcattctgctcccataaaagttcatcataatcaaacgggtaagaagtaccaatgggatgcagaaactcaaggatggattctcggttcctttttttatggctacatcatcacacagattcctggaggatatgttgccagcaaaataggggggaaaatgctgctaggatttgggatccttggcactgctgtcctcaccctgttcactcccattgctgcagatttaggagttggaccactcattgtactcagagcactagaaggactaggagagggtgttacatttccagccatgcatgccatgtggtcttcttgggctccccctcttgaaagaagcaaacttcttagcatttcatatgcaggagcacagcttgggacagtaatttctcttcctctttctggaataatttgctactatatgaattggacttatgtcttctacttttttggtactattggaatattttggtttcttttgtggatctggttagttagtgacacaccacaaaaacacaagagaatttcccattatgaaaaggaatacattctttcatcattaagaaatcagctttcttcacagaagtcagtgccgtgggtacccattttaaaatccctgccactttgggctatcgtagttgcacacttttcttacaactggactttttatactttattgacattattgcctacttatatgaaggagatcctaaggttcaatgttcaagagaatgggtttttatcttcattgccttatttaggctcttggttatgtatgatcctgtctggtcaagctgctgacaatttaagggcaaaatggaatttttcaactttatgtgttcgcagaatttttagccttataggaatgattggacctgcagtattcctggtagctgctggcttcattggctgtgattattctttggccgttgctttcctaactatatcaacaacactgggaggcttttgctcttctggatttagcatcaaccatctggatattgctccttcgtatgctggtatcctcctgggcatcacaaatacatttgccactattccaggaatggttgggcccgtcattgctaaaagtctgacccctgataacactgttggagaatggcaaaccgtgttctatattgctgctgctattaatgtttttggtgccattttctttacactattcgccaaaggtgaagtacaaaactgggctctcaatgatcaccatggacacagacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myocilin, trabecular meshwork inducible glucocorticoid response - solute carrier family 18 (vesicular acetylcholine), member 3 - solute carrier family 9 (sodium/hydrogen exchanger), member 1 - phosphatidylinositol 4-kinase, catalytic, alpha pseudogene 2 |