PHC1-polyhomeotic homolog 1 (Drosophila) Gene View larger

PHC1-polyhomeotic homolog 1 (Drosophila) Gene

PTXBC017748

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PHC1-polyhomeotic homolog 1 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PHC1-polyhomeotic homolog 1 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017748
Product type: DNA & cDNA
Ncbi symbol: PHC1
Origin species: Human
Product name: PHC1-polyhomeotic homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC017748
Gene id: 1911
Gene description: polyhomeotic homolog 1 (Drosophila)
Synonyms: EDR1; HPH1; MCPH11; RAE28; polyhomeotic-like protein 1; early development regulator 1 (homolog of polyhomeotic 1); early development regulatory protein 1; polyhomeotic-like 1; polyhomeotic homolog 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaggtacagtgcagtctggtcaggcccatttggcctcctcgccaccttcatcccaggctcctggtgcactgcaggagtgccctcccacattggcccctgggatgacccttgctcctgtgcaggggacagcacatgtggtaaagggtggggctaccacctcctcacctgttgtagcccaggtccctgctgccttctatatgcagtctgtgcacttgccgggtaaaccccagacattggctgtcaaacgcaaggctgactctgaggaggagagagatgatgtctccacattgggttcaatgcttcctgccaaggcatctccagtagcagaaagcccaaaagtcatggacgagaagagcagtcttggagaaaaagctgaatcagtggctaatgtgaatgctaatgctccaagcagtgaactagtagccttgacccccgccccttcagtaccgcctcctacactagccatggtgtctagacaaatgggtgactcaaaacccccacaggccatcgtgaagccccagattctcacccacatcattgaaggctttgttatccaggaaggagcagaacctttcccggtgggttgttctcagttactgaaggagtctgagaagccactacagactggccttccgacagggctgactgagaatcagtcaggtggccctttgggagtggacagcccatctgctgagttagataagaaggcgaatctcctgaagtgcgagtactgtgggaagtacgcccccgcagagcagtttcgtggctctaagaggttctgctccatgacttgcgctaagaggtacaatgtgagctgtagccatcagttccggctgaagaggaaaaaaatgaaagagtttcaagaagccaactatgctcgcgttcgcaggcgtggaccccgccgcagctcctctgacattgcccgtgccaagattcagggcaagtgccaccggggtcaagaagactctagccggggttcagataattccagttatgatgaagcactctctccaacatctcctgggcctttatcagtaagagctgggcatggagaacgtgacctggggaatcccaatacagctccacctacaccggaattacatggcatcaaccctgtgttcctgtccagtaatcccagccgttggagtgtagaggaggtgtacgagtttattgcttctctccaaggctgccaagagattgcagaggaatttcgctcacaggagattgatggacaggcccttttattacttaaagaagaacatcttatgagtgccatgaacatcaagctgggccctgccctcaagatctgcgccaagataaatgtcctcaaggagacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - presenilin 2 (Alzheimer disease 4)
- cholinergic receptor, muscarinic 1
- transmembrane protease, serine 6
- galactose-3-O-sulfotransferase 4

Buy PHC1-polyhomeotic homolog 1 (Drosophila) Gene now

Add to cart