GAL3ST4-galactose-3-O-sulfotransferase 4 Gene View larger

GAL3ST4-galactose-3-O-sulfotransferase 4 Gene

PTXBC012976

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GAL3ST4-galactose-3-O-sulfotransferase 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GAL3ST4-galactose-3-O-sulfotransferase 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012976
Product type: DNA & cDNA
Ncbi symbol: GAL3ST4
Origin species: Human
Product name: GAL3ST4-galactose-3-O-sulfotransferase 4 Gene
Size: 2ug
Accessions: BC012976
Gene id: 79690
Gene description: galactose-3-O-sulfotransferase 4
Synonyms: GAL3ST-4; galactose-3-O-sulfotransferase 4; beta-galactose-3-O-sulfotransferase 4; gal-beta-1,3-GalNAc 3'-sulfotransferase; galbeta1-3GalNAc 3'-sulfotransferase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccctctctctcctgccaggacgctgcggctctggggacctcggagcctgggggtggctctgggagtcttcatgaccattggctttgcactccagctcttgggagggcccttccagaggaggctacctgggctacagctccgacagccctcggccccatccctacgaccagcccttccgtcctgcccaccccggcagcgactggtgttcctgaagacacataaatccgggagcagctctgtgctgagcctgcttcaccgctatggggaccagcacgggctgcgcttcgccctccctgcccgctaccagtttggctacccaaagctcttccaggcctctagggtaaaaggctaccgcccacagggtggaggcacccagctccccttccacatcctctgtcaccacatgaggttcaacctgaaagaggtacttcaggtcatgccttctgacagcttctttttttccattgtccgagacccagcggctctggctcgctctgccttctcctactataaatccacctcatcagccttccgcaagtcaccatctttggctgccttcctggccaatcctcgaggcttctacaggcctggggcccgtggggaccactacgctcgcaacttactatggtttgactttggcctgccctttcccccagagaagagggccaagagagggaatattcatccccccagagaccccaaccccccacagctgcaggtcttgccttctggtgctggccctcgagcccaaaccctcaatcccaatgccctcatccatcctgtttccactgttactgatcatcgcagccagatatcaagccctgcctctttcgatttggggtcttcatccttcatccagtggggtctggcctggctggactctgtctttgacctggtcatggtggctgagtacttcgatgagtcattggttctgctggcagatgccctgtgctggggtctagatgacgtggtgggcttcatgcacaatgcccaggctggacataagcagggcctcagcactgtcagcaacagtggactgactgcggaggaccggcagctgactgcacgggcccgagcctggaacaacctggactgggctctctatgtccacttcaaccgcagtctctgggcacggatagagaaatacggccagggccggctgcagacagctgtggccgagctccgggctcgccgagaggccctagcgaaacattgtctggtagggggtgaggcttctgaccccaaatacatcactgatcgccggttccgccccttccagtttgggtcagctaaggttttgggctatatacttcggagtggattgagcccccaagaccaagaggaatgtgagcgcctagctacccctgagctccagtacaaggacaagctggatgtcaagcagttcccccctaccgtctcactgcccctcaagacttcaaggccactctccccataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat containing 14
- suppressor of cytokine signaling 5
- neuroepithelial cell transforming 1
- leucine rich repeat containing 41

Buy GAL3ST4-galactose-3-O-sulfotransferase 4 Gene now

Add to cart