TMC6-transmembrane channel-like 6 Gene View larger

TMC6-transmembrane channel-like 6 Gene

PTXBC035648

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMC6-transmembrane channel-like 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMC6-transmembrane channel-like 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035648
Product type: DNA & cDNA
Ncbi symbol: TMC6
Origin species: Human
Product name: TMC6-transmembrane channel-like 6 Gene
Size: 2ug
Accessions: BC035648
Gene id: 11322
Gene description: transmembrane channel-like 6
Synonyms: EV1; EVER1; EVIN1; LAK-4P; transmembrane channel-like protein 6; epidermodysplasia verruciformis 1; epidermodysplasia verruciformis protein 1; expressed in activated T/LAK lymphocytes; protein LAK-4; transmembrane channel like 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctcactctttcggggagagctaccgggtgggcagcacctctggcatccacgccatcaccgtcttctgctcctgggactacaaggtgacgcagaagcgggcctcccgcctccagcaggacaatattcgcacccggctgaaggagctgctggccgagtggcagctgcggcacagccccaggagcgtgtgcgggaggctgcggcaggcggctgtgctggggcttgtgtggctgctgtgtctggggaccgcgctgggctgcgccgtggccgtccacgtcttctcggagttcatgatccagagtccagaggctgctggccaggaggctgtgctgctggtcctgcccctggtggttggcctcctcaacctgggggccccctacctgtgccgtgtcctggccgccctggagccgcatgactccccggtactggaggtgtacgtggccatctgcaggaacctcatcctcaagctggccatcctggggacactgtgctaccactggctgggccgcagggtgggcgtcctgcagggccagtgctgggaggattttgtgggccaggagctgtaccggttcctggtgatggacttcgtcctcatgttgctggacacgctttttggggaactggtgtggaggattatctccgagaagaagctgaagaggaggcggaagccggagtttgacattgcccggaatgtcctggagctgatttatgggcagactctgacctggctgggggtgctcttctcgcccctcctccccgccgtgcagatcatcaagctgctgctcgtcttctatgtcaagaagaccagccttctggccaactgccaggcgccgcgccggccctggctggcctcacacatgagcaccgtcttcctcacgctgctctgcttccccgccttcctgggcgccgctgtcttcctctgctacgccgtctggcaggtgaagccctcgagcacctgcggccccttccggaccctggacaccatgtacgaggccggcagggtgtgggtgcgccacctggaggcggcaggccccagggtctcctggctgccctgggtgcaccggtacctgatggaaaacaccttctttgtcttcctggtgtcagccctgctgctggccgtgatctacctcaacatccaggtggtgcggggccagcgcaaggtcatctgcctgctcaaggagcagatcagcaatgagggtgaggacaaaatcttcttaatcaacaagcttcactccatctacgagaggaaggagagggaggagaggagcagggttgggacaaccgaggaggctgcggcaccccctgccctgctcacagatgaacaggatgcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GDP dissociation inhibitor 1
- cartilage acidic protein 1
- bone morphogenetic protein 5
- transmembrane protein 143

Buy TMC6-transmembrane channel-like 6 Gene now

Add to cart