Login to display prices
Login to display prices
GDI1-GDP dissociation inhibitor 1 Gene View larger

GDI1-GDP dissociation inhibitor 1 Gene

PTXBC000317

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GDI1-GDP dissociation inhibitor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GDI1-GDP dissociation inhibitor 1 Gene

Proteogenix catalog: PTXBC000317
Ncbi symbol: GDI1
Product name: GDI1-GDP dissociation inhibitor 1 Gene
Size: 2ug
Accessions: BC000317
Gene id: 2664
Gene description: GDP dissociation inhibitor 1
Synonyms: GDIL; MRX41; MRX48; OPHN2; RABGD1A; RABGDIA; XAP-4; rab GDP dissociation inhibitor alpha; GDI-1; guanosine diphosphate dissociation inhibitor 1; mental retardation, X-linked 48; oligophrenin-2; protein XAP-4; rab GDI alpha; rab GDP-dissociation inhibitor, alpha; testis secretory sperm-binding protein Li 208a; GDP dissociation inhibitor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgaggaatacgatgtgatcgtgctggggaccggtctcaccgaatgcatcctgtcgggcatcatgtctgtgaacgggaagaaggtgctgcacatggaccggaacccctactacgggggcgagagctcctccatcacacccctggaggagctgtataagcgttttcagttgctggaggggccccctgagtcgatgggccgaggccgagactggaatgttgacctgattcccaaattcctcatggctaacgggcagctggtaaagatgctactgtatacagaggtgactcgctacctggacttcaaggtggtggagggcagctttgtctacaaggggggcaagatctacaaagtgccgtccactgagactgaggccttggcttccaatctgatgggcatgtttgagaaacggcgcttccgcaagttcctggtgtttgtggcaaacttcgatgagaatgaccccaagacctttgagggcgttgacccccagactaccagcatgcgtgacgtctaccggaagtttgatctgggccaggatgtcatcgatttcactggccatgccctggcgctctaccgcactgatgactacctggaccagccctgccttgagaccgtcaaccgcatcaagttgtacagtgagtccctggcccggtatggcaagagcccatatttatacccgctctacggcttgggcgagctgccccagggttttgcaagattgagtgccatctatggggggacatatatgctgaacaaacctgtggatgacatcatcatggagaacggcaaggtggtgggcgtgaagtctgagggagaggtggcccgctgcaagcagctgatctgtgaccccagctacatcccggaccgtgtgcggaaggctggccaggttatccgcatcatctgtatccttagccaccccatcaagaacaccaacgacgccaactcctgccaaataatcatcccccagaaccaggtcaacaggaagtcagacatctacgtgtgcatgatctcctatgcacacaacgtggcggcccagggcaagtacatagctattgccagcactactgtggagaccacggaccctgaaaaggaggtggagccggctctggagctgttggagcccattgaccagaagtttgtggctatcagtgacttgtatgagcccattgatgatggttgtgagagccaggtgttctgttcctgctcctacgatgccaccacacactttgagacaacctgcaacgacatcaaagacatctacaaacgcatggctggcacggcctttgactttgagaacatgaagcgcaaacagaacgacgtctttggagaagctgagcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: