ZMIZ2-zinc finger, MIZ-type containing 2 Gene View larger

ZMIZ2-zinc finger, MIZ-type containing 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZMIZ2-zinc finger, MIZ-type containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZMIZ2-zinc finger, MIZ-type containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021924
Product type: DNA & cDNA
Ncbi symbol: ZMIZ2
Origin species: Human
Product name: ZMIZ2-zinc finger, MIZ-type containing 2 Gene
Size: 2ug
Accessions: BC021924
Gene id: 83637
Gene description: zinc finger, MIZ-type containing 2
Synonyms: NET27; TRAFIP20; ZIMP7; hZIMP7; zinc finger MIZ domain-containing protein 2; PIAS-like protein Zimp7; zinc finger MIZ-type containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacaccaactggccagcctcggtgcaggtcagcgtcaatgccacgccgctcaccatcgagcgtggcgacaacaagacctcgcacaagccactctacctgaagcatgtgtgccagccaggccgcaacaccatccagatcaccgtcaccgcctgctgctgctcccacctcttcgtgctgcagctagtgcaccgcccatccgtccgctcggtgctgcagggcctcctcaaaaagcgcctcctgcctgctgagcactgcatcaccaagataaagcggaacttcagcagcggcaccatccctggcacccctgggcccaacggagaggacggggtggagcagacagctatcaaggtgtccctgaagtgccccatcaccttccgcaggatccagctccctgcccgaggtcatgactgtcgccacatacagtgctttgacctggagtcgtacctgcagctcaactgtgagcgggggacttggaggtgtcctgtgtgcaacaagacagctttgctggagggcctggaggtggaccagtacatgctgggcatcctgatttacattcagaactctgactatgaggagatcaccatcgaccccacgtgcagctggaagccagtgcccgtgaagcctgacatgcacatcaaggaggagccggatgggccagcactgaagcgctgccgcaccgtgagccccgcccacgtgctcatgcccagcgtgatggagatgatcgccgccctgggccccggcgctgccccctttgcccccctgcagcccccctcagtccctgcccccagcgactaccctggccagggttccagcttcctggggcctggaactttccctgagtccttcccacccaccacgcccagcaccccaacccttgctgagttcaccccgggaccaccccccatctcctaccagtctgacattcccagcagcctcctgacttcagagaagtctaccgcctgcctcccaagccagatggcaccagcaggtcacctggaccccactcacaatcctgggacaccaggactacacacctccaaccttggggcccctccaggtccccagctgcaccattcaaaccctcccccagcgtcccggcagtccttgggccaagcgagcttaggacctacgggtgaactggccttcagtcctgccacaggcgtgatggggccccccagcatgtctggagccggggaggccccagaaccagctctggacctgctcccggaactgaccaaccctgatgagctactgtcctacttgggcccacccgacctccctacgaacaacaatgacgacctgctttctctgtttgagaacaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polyhomeotic homolog 1 (Drosophila)
- presenilin 2 (Alzheimer disease 4)
- cholinergic receptor, muscarinic 1
- transmembrane protease, serine 6

Buy ZMIZ2-zinc finger, MIZ-type containing 2 Gene now

Add to cart