TDO2-tryptophan 2,3-dioxygenase Gene View larger

TDO2-tryptophan 2,3-dioxygenase Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TDO2-tryptophan 2,3-dioxygenase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TDO2-tryptophan 2,3-dioxygenase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005355
Product type: DNA & cDNA
Ncbi symbol: TDO2
Origin species: Human
Product name: TDO2-tryptophan 2,3-dioxygenase Gene
Size: 2ug
Accessions: BC005355
Gene id: 6999
Gene description: tryptophan 2,3-dioxygenase
Synonyms: TDO; TPH2; TRPO; tryptophan 2,3-dioxygenase; tryptamin 2,3-dioxygenase; tryptophan oxygenase; tryptophan pyrrolase; tryptophanase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgggtgcccatttttaggaaacaactttggatatacttttaaaaaactccccgtagaaggcagcgaagaagacaaatcacaaactggtgtgaatagagccagcaaaggaggtcttatctatgggaactacctgcatttggaaaaagttttgaatgcacaagaactgcaaagtgaaacaaaaggaaataaaatccatgatgaacatctttttatcataactcatcaagcttatgaactctggtttaagcaaatcctctgggagttggattctgttcgagagatctttcagaatggccatgtcagagatgaaaggaacatgcttaaggttgtttctcggatgcaccgagtgtcagtgatcctgaaactgctggtgcagcagttttccattctggagacgatgacagccttggacttcaatgacttcagagagtacttatctccagcatcaggcttccagagtttgcaattccgactattagaaaacaagataggtgttcttcagaacatgagagtcccttataacagaagacattatcgtgataacttcaaaggagaagaaaatgaactgctacttaaatctgagcaggaaaagacacttctggaattagtggaggcatggctggaaagaactccaggtttagagccacatggatttaacttctggggaaagcttgaaaaaaatatcaccagaggcctggaagaggaattcataaggattcaggctaaagaagagtctgaagaaaaagaggaacaggtggctgaatttcagaagcaaaaagaggtgctactgtccttatttgatgagaaacgtcatgaacatctccttagtaaaggtgaaagacggctgtcatacagagcacttcagggagcattgatgatatatttttacagggaagagcctaggttccaggtgccttttcagttgctgacttctcttatggacatagattcactgatgaccaaatggagatataaccatgtgtgcatggtgcacagaatgctgggcagcaaagctggcaccggtggttcctcaggctatcactacctgcgatcaactgtgagtgataggtacaaggtatttgtagatttatttaatctttcaacatacctgattccccgacactggataccgaagatgaacccaaccattcacaaatttctatatacagcagaatactgtgatagctcctacttcagcagtgatgaatcagattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 22
- casein kinase 1, epsilon
- E2F transcription factor 8
- PBX/knotted 1 homeobox 1

Buy TDO2-tryptophan 2,3-dioxygenase Gene now

Add to cart