PKNOX1-PBX/knotted 1 homeobox 1 Gene View larger

PKNOX1-PBX/knotted 1 homeobox 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PKNOX1-PBX/knotted 1 homeobox 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PKNOX1-PBX/knotted 1 homeobox 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007746
Product type: DNA & cDNA
Ncbi symbol: PKNOX1
Origin species: Human
Product name: PKNOX1-PBX/knotted 1 homeobox 1 Gene
Size: 2ug
Accessions: BC007746
Gene id: 5316
Gene description: PBX/knotted 1 homeobox 1
Synonyms: homeobox protein PKNOX1; PREP1; pkonx1c; PBX/knotted homeobox 1; Pbx regulating protein-1; homeobox protein PREP-1; human homeobox-containing protein; PBX/knotted 1 homeobox 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggctacacagacattaagtatagacagctatcaagatgggcaacagatgcaagtagtaacagagttaaagacagaacaagatccaaactgctctgaacccgatgcagaaggagtgagccctccccctgtggagtctcagaccccgatggatgtggacaagcaggccatttataggcatccactatttccattattagctttgttgtttgaaaaatgtgaacaatctacacagggctctgaaggcacaacttctgccagttttgatgtagacatcgaaaattttgtaagaaagcaagagaaggaagggaaacctttcttttgtgaagatccagaaaccgataatttaatggtaaaagcaatccaggttttgcgcattcatcttcttgagctggaaaaggttaacgaactctgcaaagatttctgcagtcgatacattgcttgtctgaaaacaaaaatgaacagtgaaactctgttgagtggagagcctggaagcccgtactcaccagtgcagtcccagcagattcaaagtgccatcacaggcaccatcagccctcagggaattgtggtgccggcgtccgcgctgcagcagggaaacgtagccatggcgacggtggcaggtggcacagtgtatcagcctgtcacggtcgtcactccccaaggccaagtggtcacacagacattgtcgcctgggacaattaggatccagaactcccagcttcagttacagttaaaccaagatctcagcatcttgcatcaagatgatggttcatctaagaacaagaggggcgtcctgccaaagcatgccacgaacgtgatgcggtcctggctcttccagcacatcgggcatccctacccaacagaggatgagaaaaaacagattgctgctcagacaaatttgacactactccaagtcaacaactggttcatcaatgccagaagacgaattcttcagccaatgttggattcaagttgttcagagacccccaaaacaaagaaaaaaactgctcagaaccggccagttcagaggttttggcctgattctattgcatcaggagtcgcacagccaccgccgagcgagctcaccatgtcggaaggagctgttgtcaccatcaccacgcccgtgaacatgaacgtggacagccttcagtctctgtcctcggacggggccaccctggcggtgcagcaggtcatgatggcagggcagagcgaggacgagtctgtggacagcacagaggaggatgcgggtgccctggcccctgcccacatcagcgggctggtcttggagaacagtgactccctgcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lipase maturation factor 1
- retinoid X receptor, gamma
- glycine receptor, alpha 3
- centrosomal protein 55kDa

Buy PKNOX1-PBX/knotted 1 homeobox 1 Gene now

Add to cart