Cart 10 Product Products 1 459,70 € (empty)
-
1 x SPP1-secre...121,50 € -
1 x SPATA7-spe...121,50 € -
1 x SPATA19-sp...113,40 € -
1 x SPATA8-spe...113,40 € -
1 x FLJ42875-h...113,40 € -
-
1 x SPATA4-spe...121,50 € -
1 x TMPO-thymo...121,50 € -
1 x DDI1-DDI1,...121,50 € -
No products
To be determined Shipping
1 459,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 459,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 459,70 €
Data sheet of KIAA0652-KIAA0652 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA0652-KIAA0652 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006191 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA0652 |
| Origin species: | Human |
| Product name: | KIAA0652-KIAA0652 Gene |
| Size: | 2ug |
| Accessions: | BC006191 |
| Gene id: | 9776 |
| Gene description: | KIAA0652 |
| Synonyms: | KIAA0652; PARATARG8; autophagy-related protein 13; ATG13 autophagy related 13 homolog; autophagy related 13 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaactgatctcaattcccaggacagaaaggacctggacaagtttattaaattttttgccctcaagactgtccaagtgattgtccaggctcggcttggtgaaaagatttgcactcgttcatcatcttctccaacgggttcagattggttcaacttagcaatcaaagacatcccagaggttacacatgaagcaaagaaggcactggcaggacagctgcctgcagtcgggaggtccatgtgtgtggagatttcacttaagacttctgagggagattccatggagctggaaatatggtgtcttgaaatgaatgaaaagtgtgataaagaaatcaaagtttcctacacggtgtacaacagactgtcattgctgctgaagtcccttcttgctataactagggtgacaccagcctataggctctccaggaaacaagggcatgaatatgtcatattatacaggatatattttggagaagttcagctgagtggcttaggagaaggcttccagacagttcgtgttgggacagtgggcacccctgtgggcaccatcactctttcttgtgcttacagaattaacttggcattcatgtctaccaggcaatttgagaggaccccacctatcatggggattattattgatcactttgtggaccgtccctatcccagctcctctcccatgcacccctgcaattacagaactgctggtgaggacactggagtaatatacccgtctgtagaagactctcaagaagtgtgtaccacctctttttccacctccccaccatcccagctgatggttcctgggaaggaaggtggggtaccccttgctcccaaccagcctgtccatggtacccaggctgaccaggagagactggcaacctgcaccccttctgacagaacccactgtgctgccacaccctccagtagtgaggatactgaaaccgtatcaaacagcagtgagggacgggcctcccctcacgatgtcttggagaccatctttgtccgaaaagtgggggcttttgtcaacaaacccattaaccaggtgaccctgacgagtttggatataccctttgccatgtttgctcccaagaatttggagctggaggataccgatccaatggtgaatcctccagattccccagagactgaatctcctctccagggcagcctgccttgcagctggccccttccctgcctgctgtcaccatccactgtttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gasdermin B - drebrin-like - homeobox D3 - homeobox A3 |