Cart 31 Product Products 5 711,10 € (empty)
-
1 x CSHL1-chor...113,40 € -
-
1 x UCK1-uridi...113,40 € -
-
-
1 x HIST1H1E-h...113,40 € -
-
-
1 x RAP1B-RAP1...113,40 € -
1 x PPIB-pepti...113,40 € -
-
1 x SP6-Sp6...121,50 € -
-
1 x FGG-fibrin...121,50 € -
1 x PDIK1L-PDL...121,50 € -
1 x MAP1D-meth...121,50 € -
-
-
-
-
1 x HIST1H4G-h...113,40 € -
-
1 x MAPKAPK5-m...121,50 € -
-
-
-
1 x TNFAIP8L1-...113,40 € -
1 x TRAIP-TRAF...121,50 € -
1 x ZNF3-zinc...121,50 € -
1 x JTB-jumpin...113,40 € -
1 x C12orf45-c...113,40 €
No products
To be determined Shipping
5 711,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 31 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 711,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 711,10 €
Data sheet of GSDMB-gasdermin B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GSDMB-gasdermin B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025682 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GSDMB |
| Origin species: | Human |
| Product name: | GSDMB-gasdermin B Gene |
| Size: | 2ug |
| Accessions: | BC025682 |
| Gene id: | 55876 |
| Gene description: | gasdermin B |
| Synonyms: | GSDML; PP4052; PRO2521; gasdermin-B; gasdermin-like protein; gasdermin B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttcagcgtatttgaggaaatcacaagaattgtagttaaggagatggatgctggaggggatatgattgccgttagaagccttgttgatgctgatagattccgctgcttccatctggtgggggagaagagaactttctttggatgccggcactacacaacaggcctcaccctgatggacattctggacacagatggggacaagtggttagatgaactggattctgggctccaaggtcaaaaggctgagtttcaaattctggataatgtagactcaacgggagagttgatagtgagattacccaaagaaataacaatttcaggcagtttccagggcttccaccatcagaaaatcaagatatcggagaaccggatatcccagcagtatctggctacccttgaaaacaggaagctgaagagggaactacccttttcattccgatcaattaatacgagagaaaacctgtatctggtgacagaaactctggagacggtaaaggaggaaaccctgaaaagcgaccggcaatataaattttggagccagatctctcagggccatctcagctataaacacaagggccaaagggaagtgaccatccccccaaatcgggtcctgagctatcgagtaaagcagcttgtcttccccaacaaggagacgatgagtgctggtttggatattcatttcaggggcaaaacaaaatcctttccagaaggaaagtctttgggttcggaggattccagaaacatgaaggagaagttggaggacatggagagtgtcctcaaggacctgacagaggagaagagaaaagatgtgctaaactccctcgctaagtgcctcggcaaggaggatattcggcaggatctagagcaaagagtatctgaggtcctgatttccagggagctacacatggaggactcagacaagcctctcctaagcagcctttttaatgctgctggggtcttggtagaagcgcgtgcaaaagccattctggacttcctggatgccctcctagagctgtctgaagagcagcagtttgtggctgaggccctggagaaggggacccttcctctgttgaaggaccaggtgaaatctgtcatggagcagaactgggatgagctggccagcagtcctcctgacatggactatgaccctgaggcacgaattctctgtgcgctgtatgttgttgtctctatcctgctggagctggctgaggggcctacctctgtctcttcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - drebrin-like - homeobox D3 - homeobox A3 - KIAA1430 |