RAD9A-RAD9 homolog A (S. pombe) Gene View larger

RAD9A-RAD9 homolog A (S. pombe) Gene

PTXBC014848

New product

121,50 € tax excl.

Data sheet of RAD9A-RAD9 homolog A (S. pombe) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAD9A-RAD9 homolog A (S. pombe) Gene

Proteogenix catalog: PTXBC014848
Ncbi symbol: RAD9A
Product name: RAD9A-RAD9 homolog A (S. pombe) Gene
Size: 2ug
Accessions: BC014848
Gene id: 5883
Gene description: RAD9 homolog A (S. pombe)
Synonyms: cell cycle checkpoint control protein RAD9A; DNA repair exonuclease rad9 homolog A; RAD9 homolog A; hRAD9; RAD9 checkpoint clamp component A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagtgcctggtcacgggcggcaacgtgaaggtgctcggcaaggccgtccactccctgtcccgcatcggggacgagctctacctggaacccttggaggacgggctctccctccggacggtgaactcctcccgctctgcctatgcctgctttctctttgccccgctcttcttccagcaataccaggcagccacccctggtcaggacctgctgcgctgtaagatcctgatgaagtctttcctgtctgtcttccgctcactggcgatgctggagaagacggtggaaaaatgctgcatctccctgaatggccggagcagccgcctggtggtccagctgcattgcaagttcggggtgcggaagactcacaacctgtccttccaggactgtgcgtccctgcaggccgtcttcgacccagcctcgtgcccccacatgctccgcgccccagcacgggttctgggggaggctgttctgcccttctctcctgcactggctgaagtgacgctgggcattggccgtggccgcagggtcatcctgcgcagctaccacgaggaggaggcagacagcactgccaaagccatggtgactgagatgtgccttggagaggaggatttccagcagctgcaggcccaggaaggggtggccatcactttctgcctcaaggaattccgggggctcctgagctttgcagagtcagcaaacttgaatcttagcattcattttgatgctccaggcaggcccgccatcttcaccatcaaggactctttgctggacggccactttgtcttggccacactctcagacaccgactcgcactcccaggacctgggctccccagagcgtcaccagccagtgcctcagctccaggctcacagcacaccccacccggacgactttgccaatgacgacattgactcttacatgatcgccatggaaaccactataggcaatgagggctcgcgggtgctgccctccatttccctttcacctggcccccagccccccaagagccccggtccccactccgaggaggaagatgaggctgagcccagtacagtgcctgggactcccccacccaagaagttccgctcactgttcttcggctccatcctggcccctgtacgctccccccagggccccagccctgtgctggcggaagacagtgagggtgaaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

Buy RAD9A-RAD9 homolog A (S. pombe) Gene now

Add to cart