Login to display prices
Login to display prices
TM7SF2-transmembrane 7 superfamily member 2 Gene View larger

TM7SF2-transmembrane 7 superfamily member 2 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TM7SF2-transmembrane 7 superfamily member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TM7SF2-transmembrane 7 superfamily member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038353
Product type: DNA & cDNA
Ncbi symbol: TM7SF2
Origin species: Human
Product name: TM7SF2-transmembrane 7 superfamily member 2 Gene
Size: 2ug
Accessions: BC038353
Gene id: 7108
Gene description: transmembrane 7 superfamily member 2
Synonyms: ANG1; DHCR14A; NET47; delta(14)-sterol reductase; C-14 sterol reductase; another new gene 1 protein; delta-14-SR; sterol C14-reductase; transmembrane 7 superfamily member 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccccactcagggcccccgggccccgctggaattcggagggcccctgggcgccgcggctctgctactgctgctgcccgccaccatgttccacctgctcctggcggcccgttcgggccccgcgcgcctgctgggtccacccgcgtccctgcccgggctggaggtgctgtggagcccacgggcgctgctgctgtggctcgcctggctcggcctgcaggcggcgctctacctactgccggcgcgcaaggtggccgaggggcaggaattgaaggacaagagtcgcctgcgctatcctattaacggcttccaggccctggtgctgacagccctgttggtggggctggggatgtcagcggggctgcctctgggggcgctcccggaaatgctcctgcccttggcgtttgtcgccaccctcaccgctttcatcttcagcctctttctctacatgaaggcgcaggtagccccagtttcggccctggcacctggggggaactcaggcaatccgatttacgacttttttctgggacgagagctcaaccctcgtatctgtttcttcgacttcaaatatttctgtgaactgcgacccggcctcatcggctgggtcctcatcaacctggccctgttgatgaaggaggcagagcttcgaggcagtccctcactggccatgtggctggtcaatggcttccagttgctctacgtgggtgatgccctctggcacgaggaggccgtcctcaccaccatggatatcacacatgacgggtttggcttcatgctggcgtttggggacatggcctgggtgcccttcacctacagcctgcaggcccagttcctgctgcaccacccgcagcccctggggttgcccatggcctctgtcatctgcctcatcaatgggcttgagaccatctctacagccacagggcggaaactgctggtgtctgggtggtggggtatggtccgccatcccaactatcttggagacctcatcatggctctggcttggtccttgccctgcggggtgtcacacctgctgccctacttctacctcctctacttcaccgcgctgctggtgcaccgtgaggcccgggatgagcggcagtgcctgcagaagtacggcctggcctggcaggagtactgccggcgtgcgccttaccgcatcatgccctacatctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 35, member B3
- transmembrane 7 superfamily member 2
- transmembrane 7 superfamily member 2
- IKAROS family zinc finger 5 (Pegasus)