Login to display prices
Login to display prices
SLC35B3-solute carrier family 35, member B3 Gene View larger

SLC35B3-solute carrier family 35, member B3 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC35B3-solute carrier family 35, member B3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC35B3-solute carrier family 35, member B3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006973
Product type: DNA & cDNA
Ncbi symbol: SLC35B3
Origin species: Human
Product name: SLC35B3-solute carrier family 35, member B3 Gene
Size: 2ug
Accessions: BC006973
Gene id: 51000
Gene description: solute carrier family 35, member B3
Synonyms: C6orf196; CGI-19; adenosine 3'-phospho 5'-phosphosulfate transporter 2; 3' phosphoadenosine 5' phosphosulfate transporter 2; PAPS transporter 2; solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3; solute carrier family 35 member B3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacttgacacagcaagcaaaagacatacagaacataacagtccaggaaaccaacaaaaataactctgaaagcattgaatgcagcaaaataacaatggatctcaagttcaacaattccaggaaatatatttctatcactgtgccatccaaaacccaaacaatgtcaccacacatcaagtcagttgacgacgttgtggtacttggcatgaatctcagcaagtttaacaaacttactcagtttttcatatgtgttgctggagtttttgtattttacctaatttatgggtatttacaggaattaatattttcagtggagggttttaagtcctgtggctggtaccttaccttagtgcagtttgccttttactccatatttggcctaatagaacttcagcttattcaggacaaaaggaggagaataccaggaaaaacctacatgataatagcttttctaactgtgggtactatggggttatcaaacacttccttgggctacctgaattaccctacccaagtcatcttcaagtgctgcaaattgattcctgttatgctaggaggagtttttattcaaggaaagcgttataatgttgcagatgtgtctgctgccatatgtatgagccttggcctgatatggtttaccctcgctgacagcacaactgcaccaaatttcaacctgacgggtgtggtgcttatttccctggcactatgtgcagatgccgtcattggaaatgttcaagagaaagctatgaaacttcataatgcttctaattctgaaatggtattgtattcgtattcaattggttttgtatacattttactgggattgacatgcactagtggattaggccctgcagtaacattttgtgcaaagaatccagttcggacctatggttatgcgttccttttttccctcactggatattttggaatctcctttgttctggctttgattaaaatttttggtgcacttattgctgtaacagtgacaacaggaagaaaagcaatgaccattgtactttcgtttatattctttgctaaaccattcacgtttcagtatgtatggtctggtttgttagttgtccttggtatatttctcaatgtttacagcaaaaatatggataaaataagactaccatcactgtatgatttgataaacaaatcagtggaagcaagaaagtcaaggacgctggcacagactgtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane 7 superfamily member 2
- transmembrane 7 superfamily member 2
- IKAROS family zinc finger 5 (Pegasus)
- solute carrier family 35, member A5