Login to display prices
Login to display prices
PIPOX-pipecolic acid oxidase Gene View larger

PIPOX-pipecolic acid oxidase Gene

PTXBC008960

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PIPOX-pipecolic acid oxidase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PIPOX-pipecolic acid oxidase Gene

Proteogenix catalog: PTXBC008960
Ncbi symbol: PIPOX
Product name: PIPOX-pipecolic acid oxidase Gene
Size: 2ug
Accessions: BC008960
Gene id: 51268
Gene description: pipecolic acid oxidase
Synonyms: LPIPOX; peroxisomal sarcosine oxidase; L-pipecolate oxidase; L-pipecolic acid oxidase; PSO; pipecolic acid oxidase; pipecolic acid and sarcosine oxidase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctcagaaagatctctgggacgccattgtgattggggcggggatccagggctgcttcactgcataccacctggccaaacacaggaagaggatcctcctgctggagcagttctttctaccacactcccgaggaagctcccatggacaaagccggataatccgaaaggcgtacctggaagacttttacacccggatgatgcatgagtgctatcagatatgggcccagctggagcacgaggctggaacccaattgcacaggcagactggattactgctgctgggaatgaaagagaatcaagaattaaagacaatccaggccaatctgtcgaggcagagggtagaacaccagtgtctttcatctgaggaactgaagcaacgtttcccaaatattcggttgcccaggggagaagtggggctcttggacaattccggaggagttatctatgcatataaggccctcagagccctgcaggatgcaattcgacagctaggaggcatagtgcgtgacggagagaaggtggtggagataaacccagggctactggtcacggtgaaaaccacctccaggagctaccaagctaagagcttggtcatcacagcaggtccttggaccaaccagctcctccgtcccctgggcattgagatgcctctccagaccctgcggatcaacgtgtgttactggcgagagatggttcctgggagctatggtgtgtcccaggcctttccgtgcttcctgtggctgggcttgtgtccccaccacatctacggactgcccacaggagagtacccagggctgatgaaggtcagctatcaccacggcaaccacgcagaccctgaggagcgggactgccccacagcacgcacagacatcggagacgtccagatcctgagcagctttgtcagagatcacttacctgatctgaagcccgagcctgctgtcattgagagctgcatgtacacgaatacccctgatgagcagttcattctcgatcgccacccaaagtatgacaacattgtcattggtgctggattctctgggcacgggttcaagctggcccctgtggtggggaagatcctgtatgaattaagcatgaaattaacaccatcttatgacttggcaccttttcgaatcagccgtttcccaagcctgggcaaagcccacctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice