KLF12-Kruppel-like factor 12 Gene View larger

KLF12-Kruppel-like factor 12 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLF12-Kruppel-like factor 12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KLF12-Kruppel-like factor 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019680
Product type: DNA & cDNA
Ncbi symbol: KLF12
Origin species: Human
Product name: KLF12-Kruppel-like factor 12 Gene
Size: 2ug
Accessions: BC019680
Gene id: 11278
Gene description: Kruppel-like factor 12
Synonyms: KLF12 zinc finger transcriptional repressor; AP-2rep; AP2REP; HSPC122; Krueppel-like factor 12; AP-2 repressor; AP-2rep transcription factor; transcriptional repressor AP-2rep; Kruppel like factor 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatatccatatgaagagaaaaacaataaagaatatcaacacctttgagaacagaatgttaatgcttgatgggatgccggcagtcagagtcaaaacagagcttttggaatctgaacaagggtctccaaacgtccacaactatcccgatatggaagccgttcccctgttgctaaataatgtgaaaggggagcccccggaggactcgttatctgtagatcacttccaaacacaaactgagccagtggacttgtcaataaacaaagccaggacgtcccctactgccgtttcatcctccccagtttccatgacagcatctgcctcctcaccttcttcaacttcaacctcttcatcgtcttctagtcgtctagcctcatccccaactgttatcacatcagtatcttcagcgtcatcttcgtcaacagtattaactccagggccccttgtggcctctgcatctggtgttggaggccagcagtttttgcacattatccatcccgtaccgccttcaagtcccatgaatttacagtctaacaaactgagtcatgttcaccgcatccccgtggtggtacagtcggtgcctgttgtctacacagctgtaaggtcacctggaaatgtgaacaacactattgtcgtgccgcttttggaggatgggagaggccatggcaaagcacaaatggacccccgaggcctatctcccagacaaagtaaaagtgacagtgatgatgatgacctgccaaatgtgaccttagatagcgttaatgaaactggatctacggccctttccatagccagagcagtacaagaggtacatccgtccccagtatcaagggtccggggaaatcgaatgaataatcaaaagtttccttgttcaatttcaccatttagtattgagagcacaagacgccagagacggtctgaatccccagactccagaaaacggcgtatccacagatgtgattttgagggatgcaacaaagtgtacacaaaaagttctcacctgaaggctcaccggaggacacatacaggagagaaaccttacaagtgtacctgggaaggctgcacctggaagttcgctcgttcagatgaactgacgaggcattaccgcaaacatacgggagtgaagccattcaagtgcgcggactgtgatcgcagcttttcccggtcagatcatttggccctgcaccgccggaggcatatgttggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - aminopeptidase-like 1
- YY1 transcription factor
- Kruppel-like factor 15
- zinc finger protein 25

Buy KLF12-Kruppel-like factor 12 Gene now

Add to cart