Login to display prices
Login to display prices
SEH1L-SEH1-like (S. cerevisiae) Gene View larger

SEH1L-SEH1-like (S. cerevisiae) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SEH1L-SEH1-like (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SEH1L-SEH1-like (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012430
Product type: DNA & cDNA
Ncbi symbol: SEH1L
Origin species: Human
Product name: SEH1L-SEH1-like (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012430
Gene id: 81929
Gene description: SEH1-like (S. cerevisiae)
Synonyms: SEC13L; SEH1A; SEH1B; Seh1; nucleoporin SEH1; SEC13-like protein; nup107-160 subcomplex subunit SEH1; sec13 like protein; SEH1 like nucleoporin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttgtggctcgcagcatcgcggcggaccacaaggatctcatccacgatgtctctttcgacttccacgggcggcggatggcaacctgctccagcgatcagagcgttaaggtctgggataaaagtgaaagtggtgattggcattgtactgctagctggaagacacatagtggatctgtatggcgtgtgacatgggcccatcctgaatttgggcaggttttggcttcctgttcttttgaccgaacagctgctgtatgggaagaaatagtaggagaatcaaatgataaactgcgaggacagagccactgggttaaaaggacaactctggtggatagcagaacatctgttactgatgtgaagtttgctcccaagcacatgggtcttatgttagcaacctgttccgcagatggtatagtaagaatctatgaggcaccagatgttatgaatctcagccagtggtctttgcagcatgagatctcatgtaagctaagctgtagttgtatttcttggaacccttcaagctctcgtgctcattcccccatgatcgccgtaggaagtgatgacagtagccccaacgcaatggccaaggttcagatttttgaatataatgaaaacaccaggaaatatgcaaaagctgaaactcttatgacagtcactgatcctgttcatgatattgcattcgctccaaatttgggaagatctttccatattctagcaatagcgaccaaagatgtgagaatttttacattaaagcctgtgaggaaagaactgacttcctctggtgggccaacaaagtttgaaatccatatagtggctcagttcgataatcataattctcaggtctggcgagtgagttggaatataacaggaacggtgctagcatcttcaggagatgatgggtgtgtaagattgtggaaagctaattatatggacaattggaagtgtactggtattttgaaaggtaatgggagcccagtcaatgggagttctcagcagggaacctcaaatccttccctaggttcaactattccaagtcttcagaattcattaaatggatcttctgctggcagaaagcacagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - acid phosphatase, prostate
- RAD9 homolog A (S. pombe)
- transmembrane protein 79
- Ras-related GTP binding C