SERTAD4-SERTA domain containing 4 Gene View larger

SERTAD4-SERTA domain containing 4 Gene

PTXBC012083

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SERTAD4-SERTA domain containing 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SERTAD4-SERTA domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012083
Product type: DNA & cDNA
Ncbi symbol: SERTAD4
Origin species: Human
Product name: SERTAD4-SERTA domain containing 4 Gene
Size: 2ug
Accessions: BC012083
Gene id: 56256
Gene description: SERTA domain containing 4
Synonyms: DJ667H12.2; SERTA domain-containing protein 4; SERTA domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactctggttctgtccatgaatagattctgcgagcccattgtctcggaaggagctgctgaaattgctgggtaccaaacactatgggaggctgacagctacggaggcccaagccccccagggccagcacaagctcctttgcagggagaccggggagctggtcccccactggcaggatcacattacaggggaatttcaaatcctataacaacatccaagatcacatactttaagaggaagtatgtggaagaagaggattttcacccaccactcagcagctgtagccataaaaccatctcaatttttgaggaacgagcccacatcctttatatgtccttagaaaagctaaagtttatcgatgatcctgaagtgtacctccgaagatctgtccttataaacaatttgatgaaaaggatccatggagaaattatcatgcagaataactggtgcttccctgcctgctctttcaatggcacctctgcccaagagtggtttatggctcaagactgcccttaccgaaaacgaccacggatggccaaagaggaatgtgaaaagtttcatgcctgctgcttttaccaagaatgtggtggccactacctaaatttacccctttctgtcaatgctaatgttggaagtgcctccactgctgcctcctctccctccgcctcttcttcctcctcatcttcctcttcctctccccctttgcctttaccgagttgttcccgccaggtggattttgatgtaggtagtgcatctatttacaagagtgatggccagatacctgccaatgaaatctttgtcactaatgtcagatcacttggtgttcaggaaaaggccaaattaaatgatgagaaagcaaatgatgacaccaacagagatggtggccccctcagccacgaacctgtgggaaatgaccttgcttttgagtgcaaaggccaattttatgattattttgagaccggatataatgaaagaaacaatgtaaatgaatcttggaaaaagtccttacggaaaaaggaggcttcaccaccaagtaacaaactgtgctgcagcaaaggaagtaaaatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NSFL1 (p97) cofactor (p47)
- chemokine binding protein 2
- transmembrane protein 146
- bone morphogenetic protein 7

Buy SERTAD4-SERTA domain containing 4 Gene now

Add to cart