NSFL1C-NSFL1 (p97) cofactor (p47) Gene View larger

NSFL1C-NSFL1 (p97) cofactor (p47) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NSFL1C-NSFL1 (p97) cofactor (p47) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NSFL1C-NSFL1 (p97) cofactor (p47) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002801
Product type: DNA & cDNA
Ncbi symbol: NSFL1C
Origin species: Human
Product name: NSFL1C-NSFL1 (p97) cofactor (p47) Gene
Size: 2ug
Accessions: BC002801
Gene id: 55968
Gene description: NSFL1 (p97) cofactor (p47)
Synonyms: P47; UBX1; UBXD10; UBXN2C; dJ776F14.1; NSFL1 cofactor p47; NSFL1 (p97) cofactor (p47); SHP1 homolog; UBX domain-containing protein 2C; p97 cofactor p47; NSFL1 cofactor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcggagcgacaggaggcgctgagggagttcgtggcggtgacgggcgccgaggaggaccgggcccgcttctttctcgagtcggccggctgggacttgcagatcgcgctagcgagcttttatgaggacggaggggatgaagacattgtgaccatttcgcaggcaacccccagttcagtgtccagaggcacagcccccagtgataatagagtgacatccttcagagacctcattcatgaccaagatgaagatgaggaggaagaggaaggccagaggttttatgctgggggctcagagagaagtggacagcagattgttggccctcccaggaagaaaagtcccaacgagctggtggatgatctctttaaaggtgccaaagagcatggagctgtagctgtggagcgagtgaccaagagccctggagagaccagtaaaccgagaccatttgcaggaggtggctaccgccttggggcagcaccagaggaagagtctgcctatgtggcaggagaaaagaggcagcattccagccaagatgttcatgtagtattgaaactctggaagagtggattcagcctggataatggagaactcagaagctaccaagacccatccaatgcccagtttctggagtctatccgcagaggggaggtgccagcagagcttcggaggctagctcacggtggacaggtgaacttggatatggaggaccatcgggacgaggactttgtgaagcccaaaggagccttcaaagccttcactggcgagggtcagaaactgggcagcactgccccccaggtgttgagtaccagctctccagcccaacaggcagaaaatgaagccaaagccagctcttccatcttaatcgacgaatcagagcctaccacaaacatccaaattcggcttgcagacggcgggaggctggtgcagaaatttaaccacagccacaggatcagcgacatccgactcttcatcgtggatgcccggccagccatggctgccaccagctttatcctcatgactactttcccgaacaaagagctggctgatgagagccagaccctgaaggaagccaacctgctcaatgctgtcatcgtgcagcggttaacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine binding protein 2
- transmembrane protein 146
- bone morphogenetic protein 7
- carboxypeptidase B1 (tissue)

Buy NSFL1C-NSFL1 (p97) cofactor (p47) Gene now

Add to cart