Login to display prices
Login to display prices
CA11-carbonic anhydrase XI Gene View larger

CA11-carbonic anhydrase XI Gene

PTXBC002662

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CA11-carbonic anhydrase XI Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CA11-carbonic anhydrase XI Gene

Proteogenix catalog: PTXBC002662
Ncbi symbol: CA11
Product name: CA11-carbonic anhydrase XI Gene
Size: 2ug
Accessions: BC002662
Gene id: 770
Gene description: carbonic anhydrase XI
Synonyms: CARPX1; carbonic anhydrase-related protein 11; CA-RP II; CA-XI; CARP XI; CARP-2; carbonic anhydrase XI; carbonic anhydrase-related protein 2; carbonic anhydrase-related protein XI; carbonic anhydrase 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggctgcagctcgtctgagcgcccctcgagcgctggtactctgggctgcactgggggcagcagctcacatcggaccagcacctgaccccgaggactggtggagctacaaggataatctccagggaaacttcgtgccagggcctcctttctggggcctggtgaatgcagcgtggagtctgtgtgctgtggggaagcggcagagccccgtggatgtggagctgaagagggttctttatgacccctttctgcccccattaaggctcagcactggaggagagaagctccggggaaccttgtacaacaccggccgacatgtctccttcctgcctgcaccccgacctgtggtcaatgtgtctggaggtcccctcctttacagccaccgactcagtgaactgcggctgctgtttggagctcgcgacggagccggctcggaacatcagatcaaccaccagggcttctctgctgaggtgcagctcattcacttcaaccaggaactctacgggaatttcagcgctgcctcccgcggccccaatggcctggccattctcagcctctttgtcaacgttgccagtacctctaacccattcctcagtcgcctccttaaccgcgacaccatcactcgcatctcctacaagaatgatgcctactttcttcaagacctgagcctggagctcctgttccctgaatccttcggcttcatcacctatcagggctctctcagcaccccgccctgctccgagactgtcacctggatcctcattgaccgggccctcaatatcacctcccttcagatgcactccctgagactcctgagccagaatcctccatctcagatcttccagagcctcagcggtaacagccggcccctgcagcccttggcccacagggcactgaggggcaacagggacccccggcaccccgagaggcgctgccgaggccccaactaccgcctgcatgtggatggtgtcccccatggtcgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: