NDRG4-NDRG family member 4 Gene View larger

NDRG4-NDRG family member 4 Gene

PTXBC011795

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDRG4-NDRG family member 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDRG4-NDRG family member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011795
Product type: DNA & cDNA
Ncbi symbol: NDRG4
Origin species: Human
Product name: NDRG4-NDRG family member 4 Gene
Size: 2ug
Accessions: BC011795
Gene id: 65009
Gene description: NDRG family member 4
Synonyms: protein NDRG4; BDM1; SMAP-8; SMAP8; N-myc downstream-regulated gene 4 protein; brain development-related molecule 1; smooth muscle-associated protein 8; vascular smooth muscle cell-associated protein 8; NDRG family member 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggagtgctgggatggggaacatgacatcgagacaccctacggccttctgcatgtagtgatccggggctcccccaaggggaaccgcccagccatcctcacctaccatgatgtgggcctcaaccacaaactatgcttcaacaccttcttcaacttcgaggacatgcaggagatcaccaagcactttgtggtgtgtcacgtggatgcccctggacaacaggtgggggcgtcgcagtttcctcaggggtaccagttcccctccatggagcagctggctgccatgctccccagcgtggtgcagcatttcgggttcaagtatgtgattggcatcggagtgggcgccggagcctatgtgctggccaagtttgcactcatcttccccgacctggtggaggggctggtgctggtgaacatcgaccccaatggcaaaggctggatagactgggctgccaccaagctctccggcctaactagcactttacccgacacggtgctctcccacctcttcagccaggaggagctggtgaacaacacagagttggtgcagagctaccggcagcagattgggaacgtggtgaaccaggccaacctgcagctcttctggaacatgtacaacagccgcagagacctggacattaaccggcctggaacggtgcccaatgccaagacgctccgctgccccgtgatgctggtggttggggataatgcacccgctgaggacggggtggtggagtgcaactccaaactggacccgaccactacgaccttcctgaagatggcagactctggagggctgccccaggtcacacagccagggaagctgactgaagccttcaaatacttcctgcaaggcatgggctacatgccctcagccagcatgacccgcctggcacgctcccgcactgcatccctcaccagtgccagctcggtggatggcagccgcccacaggcctgcacccactcagagagcagcgaggggctgggccaggtcaaccacaccatggaggtgtcctgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - DMRT-like family C2
- synaptotagmin-like 2
- NCK adaptor protein 1
- surfactant protein B

Buy NDRG4-NDRG family member 4 Gene now

Add to cart