ADORA1-adenosine A1 receptor Gene View larger

ADORA1-adenosine A1 receptor Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADORA1-adenosine A1 receptor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ADORA1-adenosine A1 receptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026340
Product type: DNA & cDNA
Ncbi symbol: ADORA1
Origin species: Human
Product name: ADORA1-adenosine A1 receptor Gene
Size: 2ug
Accessions: BC026340
Gene id: 134
Gene description: adenosine A1 receptor
Synonyms: RDC7; adenosine receptor A1; adenosine A1 receptor variant 1; adenosine A1 receptor variant 2; adenosine A1 receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgccctccatctcagctttccaggccgcctacatcggcatcgaggtgctcatcgccctggtctctgtgcccgggaacgtgctggtgatctgggcggtgaaggtgaaccaggcgctgcgggattccaccttctgcttcatcgtgccgctggcggtggctgatgtggccgtgggtgccctggtcatccccctcgccatcctcatcaacattgggccacagacctacttccacacctgcctcatggttgcctgtccggtcctcatcctcacccagagctccatcctggccctgctggcaattgctgtggaccactacctccgggtcaagatccctctccggtacaagatggtggtgaccccccggagggcggcggtggccatagccggctgctggatcctctccttcgtggtgggactgacccctatgtttggctggaacaatctgagtgcggtggagcgggcctgggcagccaacggcagcatgggggagcccgtgatcaagtgcgagttcgagaaggtcatcagcatggagtacatggtctacttcaacttctttgtgtgggtgctgcccccgcttctcctcatggtcctcatctacctggaggtcttctacctaatccgcaagcagctcaacaagaaggtgtcggcctcctccggcgacccgcagaagtactatgggaaggagctgaagatcgccaagtcgctggccctcatcctcttcctctttgccctcagctggctgcctttgcacatcctcaactgcatcaccctcttctgccagtcctgccacaagcccagcatccttacctacattgccatcttcctcacgcacggcaactcggccatgaaccccattgtctatgccttccgcatccagaagttccgcgtcaccttccttaagatttggaatgaccatttccgctgccagcctgcacctcccattgacgaggatctcccagaagagaggcctgatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - TraB domain containing
- lactate dehydrogenase B
- opiate receptor-like 1
- ring finger protein 34

Buy ADORA1-adenosine A1 receptor Gene now

Add to cart