Login to display prices
Login to display prices
ADORA1-adenosine A1 receptor Gene View larger

ADORA1-adenosine A1 receptor Gene

PTXBC026340

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ADORA1-adenosine A1 receptor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ADORA1-adenosine A1 receptor Gene

Proteogenix catalog: PTXBC026340
Ncbi symbol: ADORA1
Product name: ADORA1-adenosine A1 receptor Gene
Size: 2ug
Accessions: BC026340
Gene id: 134
Gene description: adenosine A1 receptor
Synonyms: RDC7; adenosine receptor A1; adenosine A1 receptor variant 1; adenosine A1 receptor variant 2; adenosine A1 receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgccctccatctcagctttccaggccgcctacatcggcatcgaggtgctcatcgccctggtctctgtgcccgggaacgtgctggtgatctgggcggtgaaggtgaaccaggcgctgcgggattccaccttctgcttcatcgtgccgctggcggtggctgatgtggccgtgggtgccctggtcatccccctcgccatcctcatcaacattgggccacagacctacttccacacctgcctcatggttgcctgtccggtcctcatcctcacccagagctccatcctggccctgctggcaattgctgtggaccactacctccgggtcaagatccctctccggtacaagatggtggtgaccccccggagggcggcggtggccatagccggctgctggatcctctccttcgtggtgggactgacccctatgtttggctggaacaatctgagtgcggtggagcgggcctgggcagccaacggcagcatgggggagcccgtgatcaagtgcgagttcgagaaggtcatcagcatggagtacatggtctacttcaacttctttgtgtgggtgctgcccccgcttctcctcatggtcctcatctacctggaggtcttctacctaatccgcaagcagctcaacaagaaggtgtcggcctcctccggcgacccgcagaagtactatgggaaggagctgaagatcgccaagtcgctggccctcatcctcttcctctttgccctcagctggctgcctttgcacatcctcaactgcatcaccctcttctgccagtcctgccacaagcccagcatccttacctacattgccatcttcctcacgcacggcaactcggccatgaaccccattgtctatgccttccgcatccagaagttccgcgtcaccttccttaagatttggaatgaccatttccgctgccagcctgcacctcccattgacgaggatctcccagaagagaggcctgatgactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: