Login to display prices
Login to display prices
LDHB-lactate dehydrogenase B Gene View larger

LDHB-lactate dehydrogenase B Gene

PTXBC002362

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LDHB-lactate dehydrogenase B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LDHB-lactate dehydrogenase B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002362
Product type: DNA & cDNA
Ncbi symbol: LDHB
Origin species: Human
Product name: LDHB-lactate dehydrogenase B Gene
Size: 2ug
Accessions: BC002362
Gene id: 3945
Gene description: lactate dehydrogenase B
Synonyms: HEL-S-281; LDH-B; LDH-H; LDHBD; TRG-5; L-lactate dehydrogenase B chain; LDH heart subunit; epididymis secretory protein Li 281; lactate dehydrogenase H chain; renal carcinoma antigen NY-REN-46; testicular secretory protein Li 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaactcttaaggaaaaactcattgcaccagttgcggaagaagaggcaacagttccaaacaataagatcactgtagtgggtgttggacaagttggtatggcgtgtgctatcagcattctgggaaagtctctggctgatgaacttgctcttgtggatgttttggaagataagcttaaaggagaaatgatggatctgcagcatgggagcttatttcttcagacacctaaaattgtggcagataaagattattctgtgaccgccaattctaagattgtagtggtaactgcaggagtccgtcagcaagaaggggagagtcggctcaatctggtgcagagaaatgttaatgtcttcaaattcattattcctcagatcgtcaagtacagtcctgattgcatcataattgtggtttccaacccagtggacattcttacgtatgttacctggaaactaagtggattacccaaacaccgcgtgattggaagtggatgtaatctggattctgctagatttcgctaccttatggctgaaaaacttggcattcatcccagcagctgccatggatggattttgggggaacatggcgactcaagtgtggctgtgtggagtggtgtgaatgtggcaggtgtttctctccaggaattgaatccagaaatgggaactgacaatgatagtgaaaattggaaggaagtgcataagatggtggttgaaagtgcctatgaagtcatcaagctaaaaggatataccaactgggctattggattaagtgtggctgatcttattgaatccatgttgaaaaatctatccaggattcatcccgtgtcaacaatggtaaaggggatgtatggcattgagaatgaagtcttcctgagccttccatgtatcctcaatgcccggggattaaccagcgttatcaaccagaagctaaaggatgatgaggttgctcagctcaagaaaagtgcagataccctgtgggacatccagaaggacctaaaagacctgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - opiate receptor-like 1
- ring finger protein 34
- neurotensin receptor 2
- pipecolic acid oxidase