Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MYD88-myeloid differentiation primary response gene (88) Gene
PTXBC013589
New product
Data sheet of MYD88-myeloid differentiation primary response gene (88) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYD88-myeloid differentiation primary response gene (88) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013589 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYD88 |
| Origin species: | Human |
| Product name: | MYD88-myeloid differentiation primary response gene (88) Gene |
| Size: | 2ug |
| Accessions: | BC013589 |
| Gene id: | 4615 |
| Gene description: | myeloid differentiation primary response gene (88) |
| Synonyms: | myeloid differentiation primary response protein MyD88; MYD88D; mutant myeloid differentiation primary response 88; myeloid differentiation primary response gene (88); myeloid differentiation primary response 88 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcaggaggtcccggcgcggggtctgcggccccggtctcctccacatcctcccttcccctggctgctctcaacatgcgagtgcggcgccgcctgtctctgttcttgaacgtgcggacacaggtggcggccgactggaccgcgctggcggaggagatggactttgagtacttggagatccggcaactggagacacaagcggaccccactggcaggctgctggacgcctggcagggacgccctggcgcctctgtaggccgactgctcgagctgcttaccaagctgggccgcgacgacgtgctgctggagctgggacccagcattgaggaggattgccaaaagtatatcttgaagcagcagcaggaggaggctgagaagcctttacaggtggccgctgtagacagcagtgtcccacggacagcagagctggcgggcatcaccacacttgatgaccccctggggcatatgcctgagcgtttcgatgccttcatctgctattgccccagcgacatccagtttgtgcaggagatgatccggcaactggaacagacaaactatcgactgaagttgtgtgtgtctgaccgcgatgtcctgcctggcacctgtgtctggtctattgctagtgagctcatcgaaaagaggtgccgccggatggtggtggttgtctctgatgattacctgcagagcaaggaatgtgacttccagaccaaatttgcactcagcctctctccaggtgcccatcagaagcgactgatccccatcaagtacaaggcaatgaagaaagagttccccagcatcctgaggttcatcactgtctgcgactacaccaacccctgcaccaaatcttggttctggactcgccttgccaaggccttgtccctgccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sulfotransferase family, cytosolic, 1C, member 2 - sulfotransferase family, cytosolic, 1B, member 1 - membrane-spanning 4-domains, subfamily A, member 1 - heterogeneous nuclear ribonucleoprotein C (C1/C2) |