ZNF324-zinc finger protein 324 Gene View larger

ZNF324-zinc finger protein 324 Gene

PTXBC007717

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF324-zinc finger protein 324 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF324-zinc finger protein 324 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007717
Product type: DNA & cDNA
Ncbi symbol: ZNF324
Origin species: Human
Product name: ZNF324-zinc finger protein 324 Gene
Size: 2ug
Accessions: BC007717
Gene id: 25799
Gene description: zinc finger protein 324
Synonyms: ZNF324A; zinc finger protein 324A; zinc finger protein ZF5128; zinc finger protein 324
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctttgaggatgtggctgtgtacttctcccaggaggagtgggggctcctggacacagcccagagggccctgtaccgccgcgtgatgctagacaacttcgcacttgtggcctcgctgggactctccacctctcgacctcgtgtggtcatccaactggagcgtggcgaggagccctgggttcccagtggaacggacacaaccctgtccaggaccacctacaggaggcgcaaccctggttcctggagtttgacagaggatagagatgtttctggagaatggccacgagctttcccagataccccacctgggatgactactagcgtcttccctgttgccggtgcctgccacagtgtaaaaagcctgcagagacaacggggtgcctccccatctcgggagagaaaacccacgggggtgtcggtgatctactgggagaggctcctgctaggctcaggcagtgggcaagccagcgtcagcctgcgactgacctccccgcttaggcctcccgagggcgtccggcttagggaaaagacactcacagagcatgcgttgctggggaggcagcccaggacgcctgagcggcagaaaccatgtgcacaggaggtccctgggagaacctttgggagcgcccaggacctggaggctgccggcggtcggggacatcaccgaatgggtgcagtttggcaggagcctcatagactcctcggtggccaggagccctcgacctgggacgagctgggcgaggctcttcacgctggggagaagtccttcgaatgcagggcgtgcagcaaagtgttcgtgaagagctccgacctcctcaagcacctacgcacccgtgtgcggcaaggccttccggcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydrolethalus syndrome 1
- zinc finger protein 346
- cyclin-dependent kinase 2
- zinc finger protein 641

Buy ZNF324-zinc finger protein 324 Gene now

Add to cart