ZNF167-zinc finger protein 167 Gene View larger

ZNF167-zinc finger protein 167 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF167-zinc finger protein 167 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF167-zinc finger protein 167 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010555
Product type: DNA & cDNA
Ncbi symbol: ZNF167
Origin species: Human
Product name: ZNF167-zinc finger protein 167 Gene
Size: 2ug
Accessions: BC010555
Gene id: 55888
Gene description: zinc finger protein 167
Synonyms: ZNF167; ZFP; ZNF448; ZNF64; ZSCAN39; zinc finger protein with KRAB and SCAN domains 7; zinc finger protein 167; zinc finger protein 448; zinc finger protein 64; zinc finger with KRAB and SCAN domains 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccactgcaggcaggggaaatttaggcctcatccccaggagcactgctttccagaagcaagaggggcgcctgactgtgaagcaggagccagcaaaccagacctgggggcagggcagcagtctccagaagaactatcctcctgtctgcgaaatcttccggctacacttcaggcaattgtgttaccacgagatgtctgggccgcaggaagcattgagccggcttcgggagctctgccgctggtggctcatgccagaggtgcacaccaaggagcagatcctggagctgctggtgcttgagcagttcctgagcatcctccctggggagctccggacctgggtgcagctgcatcaccctgagagtggtgaggaggctgtggctgtggtggaggatttccagagacacctcagtggatcagaggaggtttcagccccagcacagaaacaggaaatgcattttgaggagacaacagctctgggtacaacaaaggaatctcctcctacctcacccctcagtgggggctcagcccctggagcccacctggagcctccttatgacccagggacacaccacctccccagtggggacttcgctcaatgtacttctccagttcctacccttcctcaagtggggaactcaggagaccaagcaggggcaactgtacttcggatggtcaggccccaggatactgtggcatatgaggacctatctgtagactacactcagaagaaatggaaaagtctcacactcagtcagagagccctgcagtggaacatgatgccagaaaatcaccatagcatggcctccttgggctggagtacaatggcgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 503
- zinc finger protein 324
- hydrolethalus syndrome 1
- zinc finger protein 346

Buy ZNF167-zinc finger protein 167 Gene now

Add to cart