Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MED4-mediator complex subunit 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MED4-mediator complex subunit 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005189 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MED4 |
| Origin species: | Human |
| Product name: | MED4-mediator complex subunit 4 Gene |
| Size: | 2ug |
| Accessions: | BC005189 |
| Gene id: | 29079 |
| Gene description: | mediator complex subunit 4 |
| Synonyms: | ARC36; DRIP36; HSPC126; TRAP36; VDRIP; mediator of RNA polymerase II transcription subunit 4; TRAP/SMCC/PC2 subunit p36; activator-recruited cofactor 36 kDa component; mediator, 34-kD subunit, homolog; vitamin D receptor-interacting protein, 36-kD; vitamin D3 receptor-interacting protein complex 36 kDa component; mediator complex subunit 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcgtcttcgagtggtgagaaggagaaggagcggctgggaggcggtttgggagtggcgggtggtaacagcacacgagagcggctgctgtctgcgcttgaggacttggaggtcctgtctagggaacttatagaaatgctggcaatttcaagaaaccagaagttgttacaggctggagaggaaaaccaggtcctggagttgttaattcaccgagatggggaatttcaagaactaatgaaattggcacttaatcagggaaaaattcatcatgaaatgcaagttttagaaaaagaagtagagaagagagacggtgatattcagcagctacaaaaacagctaaaggaagcagaacaaatactggcaacagctgtttaccaagcgaaggagaaactcaagtcaatagaaaaagcaagaaaaggtgctatctcctctgaagaaataattaagtatgcacataggatcagtgcaagtaatgctgtatgtgctccactgacctgggttccaggggacccccggagaccctacccaactgatttagagatgagaagtgggttactgggtcagatgaacaatccttccactaatggcgtgaatggccatttaccaggagatgcacttgcagcaggaagattgccagatgtccttgctccacagtatccatggcagtcaaatgacatgtcgatgaatatgttaccaccaaatcatagtagtgactttttgttggaacctcctgggcataataaagaagatgaagatgatgtagagattatgtcaacggactcctcaagcagtagtagtgagtctgattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SH2 domain containing 4A - MAD2L1 binding protein - toll interacting protein - BCL2-associated athanogene |