Login to display prices
Login to display prices
KRCC1-lysine-rich coiled-coil 1 Gene View larger

KRCC1-lysine-rich coiled-coil 1 Gene

PTXBC015927

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRCC1-lysine-rich coiled-coil 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KRCC1-lysine-rich coiled-coil 1 Gene

Proteogenix catalog: PTXBC015927
Ncbi symbol: KRCC1
Product name: KRCC1-lysine-rich coiled-coil 1 Gene
Size: 2ug
Accessions: BC015927
Gene id: 51315
Gene description: lysine-rich coiled-coil 1
Synonyms: CHBP2; lysine-rich coiled-coil protein 1; cryptogenic hepatitis-binding protein 2; lysine rich coiled-coil 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcattcaaagaagacatatgactcttttcaagatgaacttgaagattatattaaagtacagaaagccagaggcttagagccaaagacttgtttcagaaagatgaaaggggactatttggaaacctgtgggtacaaaggagaggttaattccagacccacgtatagaatgtttgaccagagactcccatctgaaaccatccagacctacccaagatcatgcaatattccacaaacagtggaaaatcggttgcctcagtggttaccagcccatgacagcagattgagactagactctctgagctactgtcagttcacgagggactgtttctcagaaaaaccagtacccctgaactttaatcaacaagaatatatttgtggctcacatggtgtagaacatagagtttacaagcacttctcctcagataacagtaccagtactcatcaagccagtcacaaacagatacatcagaagaggaaaaggcacccagaggaaggcagagaaaaatcagaggaggagcggtctaagcataagagaaaaaaaagctgcgaggaaattgacttagacaaacacaagagcatccaaagaaagaaaacagaggtggaaatagaaaccgtacatgtcagtacagaaaagcttaagaatcgaaaggagaaaaaaagccgagatgtagtctctaagaaagaggaacgtaagcgtacaaaaaagaaaaaggaacaaggccaagaaaggacagaggaggaaatgctttgggaccagtctattcttggattttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: